GenePrediction:GLEAN_4829 Details

Name: GLEAN_4829
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:41634..40410 (- strand)
Length: 1225
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:41634..41489 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_167:41430..41402 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_167:41349..40913 (- strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_167:40859..40410 (- strand)
Length: 450
>GLEAN_4829 class=GenePrediction position=GCSC_167:41634..40410 (- strand)
ATGAACGCTATCCGCCCTCTGACCGGCCTCAGGATCCCTCGAGCCTTTTTCTCCCATCCGGCAAAGGCATCCGCAGCAGC
AGTGCGATTTCTCGCAACCATGGCGGCCACGACGGATATCAGCACGTACAAGCTGAACCACACCATGTCAGTTTAGGGGA
ATGGGGTGTGCGGCGTTGTGGCCAATTGTCTAACGCAAACACAGGATCCGGGTGAAGGACCCGAAGGAATCAGGTACGCG
CGTGGAAAAAAGTACTTTTGTCACTTCAACGCTAAACCGTCACAGTCAAGTTCTACGAGTTCCTGGGCCTCAAGCAGATC
CGGAAGGAGTCCTTTCCCGAGAACAAGTTCGACCTCTACTTCCTCGCGTACGACTCGCCATCGGCCGTCTCGGCCGGCAA
CAAGACGTTTGACCGTGAGGGCGTCATCGAGCTGACGCACAACTACGGCACCGAGAACGACCCGACCTACAAGATCAACA
ACGGCAACGTCGAGCCATACCGCGGCTTCGGCCACACCTGCGTTTCCGTTGATAACATCCAGGCTGCCTGCAAGCGCATC
GAGGATGCCGGCTACCGGTTCCAGAAGAAGCTGACCGATGGCCGCATGCGCCACATTGCCTTTGTCCTCGACCCGGACGG
CTACTGGGTCGAGGTGATTGGGCAGAAGCCGCTGGCAGCCTCTGAAGGCCTGACGACGACAGATCTGACGACGTACCGGA
TGGTGAGTTTTCTCCGTCTGCTTGCTTCGCTCAGCTTTTCCTGCTGACCCGCCAGAACCACACGATGATCCGGGTCAAGG
ACGCCAAGAAGTCGATCCAGTTCTACGAAGACGTCATGGGCATGTCGCTGGTGCGCACATCCGACAACCCGGCCGCTGGC
TTCACGCTCTACTTCCTGGCCTACGGTGGCCCAGGCGAGCCGACTGGAGACGAGGGCACGGCCGGCCGTGAGGGCCTGCT
GGAGCTGACGTGGAATCACGGCACCGAAAAGGACGAGGCCTTTAGCTACCACGATGGCAACAAGGAGCCGCAGGGCTTCG
GACATATCTGTGTCTCGGTCGACAACATCGACGCAGCCTGCCAGCGGTTCGAGGACCTCAAGGTCAACTGGAAGAAGCGC
CTGACCGACGGCCGGATGAAGAACGTGGCCTTTGTCCTCGATCCGGACGCCTACTGGGTCGAGATCGTGCAGAACGAGCG
CATTGCCGGCAAGGAGAACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62