GenePrediction:GLEAN_483 Details

Name: GLEAN_483
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:111734..114161 (+ strand)
Length: 2428
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:111734..113521 (+ strand)
Length: 1788
Type: CDS
Source: GLEAN
Position: GCSC_97:113592..114161 (+ strand)
Length: 570
>GLEAN_483 class=GenePrediction position=GCSC_97:111734..114161 (+ strand)
ATGGCACGCCCAAGTCGCCAGAAGCGGAGGCTTCCGTTCCTCCACCGCAATTGGAGAGATGGAATCACAGCGTGGCAGAC
GTGGCCCTCTAGCAAGCCTCGGGCCTCCTCTCTCGGCTATGCCGATCTGCTAGGAGACCGGGAAGAGGATTTGTGTGTGC
GCCCGTCAAAACGACGCCGTGGCGGTGCTTTGCCCACGGGCATCGCACAGATTCCTAGCTTCAAGGAGTGCTCAGCCATG
TGGCTACCAGAGTACCCTACCACACGCTCCAATGGCCTGCGTGTCCAGGTGTTCAACATGTTCCATGCGGACACACCACG
GGTGCGCTTCAACACCATGGCAAACTTGCCACCGGCCGACATCGCCACCTTCAGCGTCCGCTGCAAAATCACGATTATGA
GTGAGAAGTGCGGCATGCCTCTGCTTCTGTTCTGTGATGCGCAGATAGGGACGGTACAGGCATACAGGCCCGCTGATGGG
CCGTGTGGTCTGGCACGCTTCTCGCTGGAGCCATTGACAATCCCATTGGAAAAGATTGCCATCCTGCGCGAGGAAAGCCG
CGTGTTTGGGCTTGCCGAGAAGTACAAGATGCGTATCGAGATCGAATCTACGGGAAACGACACGTGGCCACCTCTGGACC
TTCTCACTTTCATCGGCACTGTCCCAGATAGCAGCGATAGCCATCGTCGTCAGCACCATCATCGGCATCCCCTGACTAGC
CACCATGCTAAGCAGGCCGATGACTGCGTGCTGTACGCCGAATCCAACGACTTTTTTGGACGACCAAGAATGCGCATTCC
CCTGTGGCTGAGGGAGAGCCCGCTCCATGACCCGATCTGCACCAAGTTTGTGATGGATTTGGATGTCCGCTGGAGCACGG
GATTTTTAGAACAGCCGCGCAGCTTGCTGGAAAAGGGCGTTCTGCCGACTATTGTGGCTATGCATCCAGACGAGCCGATC
CCACGTCCTGCGTTGGGAAAAGCCAGCAGTCTTTCGAGGGAGGCCTTGGCGAAACGTTATCTGGAGAACGGCATTTTAGC
CAACAAACATGCCAACGGTACAAACCATCTTATGAATGGCCATATAAATGGCCGCGCAAACGGTCATGCAAACGGACGTT
TAGGCGGCTCCATTAACGGCTCTCAGAGTCGTGCCGGCGGGCGCAGTGTAACTCCCTCTGTGAATGGCGTGGACAGTGCA
GTCGAGGACGACGAGGATGACGAAGGCGACGTGGCTGAAGGGGAGCTTGCTGCAGGCCGCTCTCTGCGAAGACGACGAGG
ACATCCGGACTATAACCTTCGAACTATGACCAACAAGGTCCATGGCAAGGTACCGCGATCGCCCCGAAAATTGCGGAGCT
CTGTGCTGGAGTTTAATGGTCGTTTTAACGGCAGCCTTCACGGCCGATTTTCCAACATGGACGCTGTCGGCAACAAGGTC
ACGTACATTTTACCGCCAGAGCAGTTGACCGTGGACGGGTTTGTCTGCTGCATTTGCCTCGCCTGGAACCCAGACATCAA
CCAATTGCGAGCTCACCTCAAATGCCATTTTCACTATCACTTTGATTACGAAACGCTTCCAGGCAGTCGCGGTGGCCATA
CTGTCTACGTTTCGCATTATCCGGACGAGAGCACAATTTCCCTCCGGCCAAAAATCTACCAGCTGGGTCGGCCGACAAAA
CCGCTCGATTTGGACTCATTTCTTGCTGGCGATGAGTCTTGGGTGACCTCGCGCTTTGGGCCACAGCACGACAATAGTGG
GGTCGCTCCTGTGACCTGCGATGCACGGGTAAGGATCTGTAGCCTTCAAGCCGGTAATTTAGGGAGTGTTGCTGATGTTT
CTTGTTTTAAATTTACAGTCCAAGCAGCCGCTCCAGGTCAAGGACATCAACCTCGTTGTCCCGCATATCAAGCAGCCTCT
TTACCACCCTCTGAGCAAGGTCCTTCTCCAGCCGGGGGACAAGATTCGGCCGGTTGCTGTAGACGATAGCTGGCTCGTTC
ATAAGCATCGCGAGGTCGTGCAAGACTACTCTGACCTGTCTAGTGCCGAAAAGGAGTTTATCCAGGAGTGGGACAAATTC
GTCATATCTCGACGTGTCTCCTCCGACGCGTATATTCCCCGGACTATGCTCGAGTTTATTGAGGAGAAGGGACTGTGGCT
AGTGGCTGACCATGCTCGCACGATTGAGTTTGGAAAACACATGGCTGTGATGGTGGCGAGAAGCCTCTTGTCGAACGAGG
ACATCCAGGCAATCACATCCTGCCTCAATATCGCTAGGAAGCGCGCAAAGGAAACGCCAAGCCTCACGGCAGCCGCTGAA
GCCAGTGCCGTTCCTAAAACAGGGCCGCATAGGAGCAAGAGCGGCTGTTCCGTATGTGGATTGCCAGTGTTGGGCCCGTT
CATGCTCATCTGCTCCAACAAGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62