GenePrediction:GLEAN_4846 Details

Name: GLEAN_4846
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1049165..1046603 (- strand)
Length: 2563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1049165..1048947 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_89:1048877..1048656 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_89:1048589..1048435 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_89:1048370..1048345 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_89:1048287..1047714 (- strand)
Length: 574
Type: CDS
Source: GLEAN
Position: GCSC_89:1047660..1047388 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_89:1047323..1046603 (- strand)
Length: 721
>GLEAN_4846 class=GenePrediction position=GCSC_89:1049165..1046603 (- strand)
ATGTCGACGCTCCGGGACAAGCAGATTGCGGCGCTCAAGCGCATGCTGAACCTGAACCAGACCGACGGCAGCGATCCGGA
CCAGAAATTGGGACAGCAGCAGCAGCAGCTCGGCGTGGTCGGCCCCGATGGCGAGCTGGTCTGGAAGGTGCTCGTATTTG
ACGATCTCGGCATGCAGATCGTCAGCAGCGTCTTGCGCGTCAGCGACCTGCGATCCATGGTACCTCTTTCTGTCTTTTTT
CCCCTCTCTCCCGCCTTGTCCTCGTAGCTATCGCTAACAGAGATTTAGGGCGTGACCATGCACATGCACCTGGCGTCCAC
GCGCCACCAGATCGAAGATGTGCCTGTCGTCTACCTTGTCGAGCCGACGGCCCAGAACCTCAAGAGCATCACGAGCGATC
TGGAAAAGGGCCTCTACTCACCCGCCTACATCAACTTTCTCTCGTCCATACCACGGCCGCTGCTCGAGGAATTCGCTGCA
GAGACGGTGGCCAACGGAACACAAGAAAACGTCAGTGTCCGTCCTTAAAGGGGATTGTCCAATGACCGGACTGGAAAAAC
TGACAGTGCTCGGCAGATCGCCCAGCTCTACGACCAGTACCTCAACTTCATCTGCGCTGATCGCGACCTCTTCAGCCTCG
GCATGCAGAAAGACCACACATACTGGGCCCTCAATTCGGCACAGACGAACGATGACGAGCTGGACCACGTCGTCAACAAG
ATCGTCAGCGGGTAAGCCGCCTCGCCTGGGAGACTGTACGCAGCGAACAGGACTCCAGCTAACAATTCTTGACAGGCTCT
TCAGCGTCGTCGTCACAATGGGTTTGTATTTTTTGCTAAATTGTACCTGCCCCCGGTCATGCTGACAGGCCCCGACAGGT
GTCATTCCCATAATCCGCTGCCCCAAGGGCATGGCGGCCGAGATGATCGCGACAAAACTCGACCGCAAATTGCGCGACCA
CCTTCTGAGCTCCAAGGACAACATGTTCGCGAGCGGTGGAAGGCCGGCATCGTCGACCGGCACGCCCGTCTCACGGCCGG
TGCTCATCATCCTGGACAGAAACATTGATCTCACGACCATGCTGTCTCACTCGTGGACGTACCAGAGCCTGGTGCACGAT
GTGCTGAACATGAAGCTGAACCGCGTCTCCGTCGAGACGCCCGTCGACGAGCAGAACCCGGCCAAGGGCTCGACCAAGAA
AACCTACGACATAGCCGCCAACGACTTCTTCTGGAACAAGAACGCGCCGCTGCCTTTCCCCCAGGTAGCCGAGGACATTG
ATGCCGAGCTGAGCCGCTACAAGCAGGACACCACCGAGATTACCCGGAGGACGGGTGCCTCGTCCATCGAGGACCTGCAG
AACGACACCAGTGCCAGCGCACAGCACCTCAAGGCAGCCATAACACTGCTTCCCGAGCTGCGGGAGCGCAAGGCCGTGCT
TGACATTCACATGTAGGTTTTGTTTCTGCCGCTCTCTTTTTGCTGCAGAACTGACGCAGGGCCAGGAACATACTCGCTGC
ACTGTTGACGGGCATCAAGGACCGACAGCTCGACAACTTCTTCCAGATCGAAGAGAGCATTGCCAAGCAGACAAAGGCCC
AGGTGCTGGAGCTAATCAATGACCATACTAAGGGAACCAACGCGACAGACAAGCTGCGCCTGTTTATCATCTGGTTCCTC
ACGACCGAGCAGGAGGTCGGCCGGACCGAGTGGGCGCAGTTTGACGAGGCGCTGAAGAGTGCCGGCGCCAACACGACGTC
GCTTGGTTACATTCGGCAGTGAGTATCGCTAGCAGACGATCTAGAGTCCCGAGAGGCTTTGCTAACATACTTTCCGCTCT
AGGGTCCGAGCAACGACCAAGATGACGCAGCTGACAACGATCCACAACACGCCACAGCAGGCGTCGGCGTCCAACGACCT
GTTTGGGCGCTTCTCGTCCATCTCGTCGCGGCTCACGGACCGGCTGAAGGAGACGGGCATGCCGACGAACCTGTCGGCCA
ACCTGGAGTCAATCGTGGGCTCGATCAAGAACTTTCTGCCGGCCAACCGGGACCTGACGGTGACCAGCATCGTCGGCTCG
ATCATGGACCCGAGCACGTCCAACAGCTCGGCCATGACGAAGACGGAGAACTACCTGTACTTTGACCCGCGCAACTCGCA
CGCGCGCGGCAGCATACCGCCACCAGCGTCCATGGTGCGGGGTGGCAGCAGCAACGGTGGCGGGTCGGGAAGCAGCCTGA
GTGTAGGGGCTGGGGGCGGAGCTTCCGGTGGAGGCGGCAGCGGCAGCGGCATGCCTGGTGCCGGAGGCGGGCTAGGCGTG
CAGGGTCCGGGCACGGGTGCATCGTTTGGCCAGCGGCGACAGGGCTTCAGCGATGCCATTGTGTTTATGGTGGGCGGCGG
CAGCATCGACGAGTTTGGCAACTTGCAGGAGTGGGTAGGCCGGACGGCCGGCGGCGGCGATCGGGCAAAGCGGCGGGTTG
TGTACGGAGCGACAGAACTGTTGAATGCCGAGGAATTCTGCCGGGAAGAGCTGGAGCGATTGGGCCAGGAGACGACGACA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62