GenePrediction:GLEAN_4847 Details

Name: GLEAN_4847
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1046464..1043043 (- strand)
Length: 3422
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1046464..1046460 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_89:1046358..1045444 (- strand)
Length: 915
Type: CDS
Source: GLEAN
Position: GCSC_89:1044951..1044142 (- strand)
Length: 810
Type: CDS
Source: GLEAN
Position: GCSC_89:1044012..1043443 (- strand)
Length: 570
Type: CDS
Source: GLEAN
Position: GCSC_89:1043379..1043043 (- strand)
Length: 337
>GLEAN_4847 class=GenePrediction position=GCSC_89:1046464..1043043 (- strand)
ATGAGGTGCGCATGCGTTAGCTTTGCTGATATGACGTGCAGTGAAAGACAAGTGGAAGGAGTGGAAAGGGCCCTCAGATT
AGCTCTCTTATGGTTCTCCTTTGCAGCAAGACCTGCCTCTTCCAGGGATACGCCAACGGCCGACGAGGTTCGAGGAAGAA
GACCTCCTCGCCCCGAGATCGTCGACCGCCGGGACACCGTGGGAGAAGGACAGGCCAAGGCATCAAATTTGGCTTTTGTG
TCCATTTAAGACTTTCGCATCATAGGGCAACAAAGGAAATAACGGACGAGGCTGGGACGGAAAGCGAGCAACAGTGGCAC
GGAAGGACGATGTTTCCCCTCCAGACGTACCACCTCGCACAGACGATTCTCGCGTCAGCCCTTGCAGCTTCTTCCACGGA
GGAGAAGAGCCAGGAAGATCCTGTCTGCGATTCTCCCGGAACTCAGATTGAAAACTATTCATGGGTTTGGATAGTCATCG
GCACAGGAAGGCCAGAGGGCTTTGTGGGCGCCTGCAGTCCCTCCAACGAGGCCTCTCGGTCCAATATAAAAGATGGGTGG
TCCTCCCTGTTCCGTCCGAGCAGGCTCGGACCGGTGGAAACGCGTGAAGCAGGCCATCGCCAGAAGCGCCGCCGCACAGA
ATGGTGTCCAACACGGGAGACACTCGTCGGTCCCGCGCCCTATTTCTTGCTTTCAGCCCAGCACCCCTCCACCTGCTCAG
ATTTCTGTTCTTTCAGGAGGCCGGGAGCAGTGAGGGCGAGTCGCATTTCTGCCGCTCGCCTCGACTGTACCCGGACTCCA
TCCTCTCACGACAGCTGGAAGCCGGGTCTGGGACCCAGCTTGCGCAGCTGCATTCGAGACGGGGGTGTAGCGGGAGAGGC
GCGGACGACCGCACCTCGTCCTCGTCCCGTGTCTGGCTGTCTTCACTGCAGGGCTGGCTCGGATTTTGGTTGGGAGTATG
GCGTGCGAAAGGAAACATCGGTCGGCTCTTACCTTGGTCGGCTGTCGGCTGCCGGGAGAAGGTAGGTGGTGAATGTAGGA
GAGAAACGCGAAGAGTGCAAAAGGCGCGACGAAAGGATCCAATCCAAGGTGATTGTGGAGATCTAGTCACGTGTGTGCAG
ATCGCATCTGAGATTACTCCGTACACATCCCTTCCTTCCCCCGTGGAGCTCACAGGCGGATGTACTCCGTAGTTCGACGG
CCATTGGGAAGCCGCGCTCTCTCTCTCTCGCCTTCCTTTCCCGTCCGCTCTCGGCGAGCTAGCCCTGTCTTACGCTCTCT
GCCTATTTGCCGCCTTGCTAGCTTCTGCCTCCAGACACCACCCTGAAAGAAGCCACGGTTGCTTTAGCTGCTTCAGAGGC
CGAAGGGGTAAAAAACAGAATACGAGGCCCAGGCACCCACCTATACCGTTCGGACGAATAGAAGGCCGGCCGTACTTTTT
GGGATTGACTACGCAGTCGCATTGCCACAGTATCTTTGCCAGCTCGGTCGCTTACACTTGCACGATACACGAGATTCGCA
CACGGCCATCCGTTCTGCCTCCCGCCTCTTTCGGAATACCGACACGACCTCGACGACGGGCCCATGGGTGCCAAAGCTCG
GCGATCCAGGAGCGGCAAGCCAAACGGGCGAGCGAGCGAGACGACGCCGGACGTGGACGTGGACGCAAACGCATACGCAA
ACCAGACGCGCAGCAGCGGGCTGCGGATCGTGACCAGCAGCGGACAGGCGACGGCGATGAACACAAGCGTGGAGTACCGG
CGCAAAGGCGGACCGCAGGAGTCGGACGTGGTGACGGCCAGCCTGATGGCGCGCGAGTCGTTCTCGCTGGACGAGCAGGT
GGTGGCGACGCCGCGGCTCAACAACCACGGCTTCGGCCAGCTGCCTCGACAGGATCAGCAGAACTTTGGGCTGCTGGTGC
TGCTCTACTTTCTGCAGGGCATCCCGCTCGGACTGGCGACCGGGTCGGTGCCGTTCCTGCTGAAGCAGCACATGTCGTAC
GGCGAGATCGGCGTGTTCACGCTGGCGTCGTACCCCTACTCGCTCAAGCTGCTCTGGAGCCCGGTGGTGGACGCGCTCTG
GAGCCCGCGACTCGGCCGCCGCAAGAGCTGGATCCTGCCCATTCAGCTGCTCTCGGGCGTCGGCATGCTCTGGCTCGGCA
GCCGGGTCGAGGACTTGATGGCCACCACCGGCAAGCCGGGCGGCCCTACCGTCTGGACCTTTACCGGCTGGTGGTTCTTC
CTCGTCCTCATGTGTGCCACCCAGGACATCGCCGTCGACGGCTGGGCCCTCACTCTGCTCTCGCCCGGCAACATCTCCTA
CGCGTCCACCGCCCAGACCGTCGGCCTGACCGCTGGCAACTTCCTCTCCTACACTGTCTTCCTCGCCTTCCACTCCAAGG
ACTAAGCCAACCGTTACTTCCGTGCCGTCCCGCTCGACCACGGCCTTCTCAGCCTAGGCGGCTATCTCACCTTTTGGGGC
TGGGCTTTCATCGTCGTCACCGTCGCGCTCGCCCTGCTCAAGCGTGAGGACCGCTCGCACAACGAGGAGGGCGTCTGGGA
CGTCTACCGCATCATGTGGGGCGTCCTGAAGCTGCGCAACGTCCAGGCCATCATCCTCGTCCACCTGATCGCCAAGATCG
GCTTCCAGGCCAACGACGGCGTCACCAACCTCAAGCTGCTCGAGAAGGGCTTCGGCACTGATAACCTCGCCCTTACCGTC
CTCATCGACTTCCCCTTCGAGATCGGCCTCGGCTACTATGTCGGCAAGTGGTCCCAGGCCTACACTCCCATGCGCCTCTG
GTGCTGGGGCTTCATCGGCCGTCTGGCCGCCGCCGTCTTTGCCCAGCTGACCGTCGTCCTCTATCCGGCCGGCGGCGTCA
ACACGTCCTACCTGCTCATCGTCATCGTCGAGCACGTCATGTCCACTTTTATGAACACCATGATGTTTGTCGCCGTCTCC
GCCTTCCATGCCCGCATTGCCGATCCCGTCATCGGTGGCACCTACATGACCCTTCTGGCCACGTGAGTTTTTGTTCTTCC
TTCTCTTCCTTCTCTCCTTTCTCCTATTCTCCTCTAACCTCCCAGGGTCTGCAATCTCGGCGGCACATTCCCGCGCATCT
TTGTCCTGCGGCTCGTCGACGCCTTTACCGAGGCCACTTGCATCCCGACCTCGTCCAACCCCGGCGTCACGCTCAACGGC
CCCATCGTGACCGAACCGTTTTCGTGCTCCGTCCAGGCCGAGAAGGAGCGCTGTCTGGCCGGCTTTGGCACCTGCGAGAT
GCAGCGTGACGGATACTACATTGTCAACATCATATGTGTCCTCGTTGGCACCATCACTTTCGTAACCTTTATCCGGCCCC
AAGTTCTGCGTCTGCAGGCCCTGCCATTAAAGGCATGGCGTCTGGTCAGCACCAGATCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62