GenePrediction:GLEAN_4848 Details

Name: GLEAN_4848
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1031579..1030676 (- strand)
Length: 904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1031579..1031447 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_89:1031391..1030676 (- strand)
Length: 716
>GLEAN_4848 class=GenePrediction position=GCSC_89:1031579..1030676 (- strand)
ATGTCGTCCAAACTCATCCCGGCTAATCCGTCAGACGTTCTCGTCGTTCGGGACATCACACCCAATATAACCACATTGTC
CGTGCCGTTCTTACGTCATGGTGTAATCTATTTCGGAGGCAGAGGCACAGTTGGTGAGCAGTCTTTTATTTTGCAGTGTT
TCTGTCTCGTAGCTGACCAGCCGACTAGTGCGACTCTCCGGCGGTGGCGTGTTGCTGTTTTCGCCTGTGGCGTTGACGCC
AGAAGCAGTCGCCGTGGTCGAACGCCTTGGCGGCGGCCATGGTGTCAAGTACATCGTTGCCGGTGACATTGAACACCACA
TTTTCATATCTGAGTGGGTGAAGGCCTATCCAGAGGCACGCATCATCGCGCCTGCTGGACTGCCAGAGAAGCGAGCTGCC
ACCAAGGGCAGCGATCCCAAGATAAGCGTCGATGACAAATTCTTTGCCGTTCTGGCCGACGGGCAGTCAATGCATAAGTC
TATTTCGATTGCACCTGACTTTGACGCCGACTTCTCCGTCGTGTATAACGACGTCCACCCAAACAAGGAGATCATCCTTC
TGTACAAGCCTGACCGGGTTCTCATCGAGGCCGACCTGATGATGAATCTTCCGGCCACCGAGCAGTACTCACGCACTGAT
GCTGAAACACGGCATAATGTGGAGCATCCAAATGTTATCAATCGCATATTCTACCGGTTGATGACCACCACGGGCTCACC
CTTGGCAGGACAGCGCTTCAACTGGTATGCTGTCAGCTCTCGCAACCGGCCCCGTTTCAACGAGGCGATACAGCTGATCG
ACAAATGGGAATTTGACATCTTGATCCCATGTCACGGTGACACCATAATGGAAAACGGGAAGGAGGCTTTCCGAAAGCTT
TTTGCTTGGCATTTGGAACAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62