GenePrediction:GLEAN_484 Details

Name: GLEAN_484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:123088..124638 (+ strand)
Length: 1551
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:123088..123096 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_97:123170..123396 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_97:123462..124638 (+ strand)
Length: 1177
>GLEAN_484 class=GenePrediction position=GCSC_97:123088..124638 (+ strand)
ATGGCTGATGTATGTATTCCGCTACCATTGAGCCGTCCTTCCTCGGAGCTACGAGAGATCTAACAGGATCTCCCTCTGCC
AGACAGTGGTGACCACCTCGGAGAGCAAGGAGCTCCGGGGCCTCAACCTTATAGCTGCCCATTCGCATATTCGCGGACTC
GGCGTCGATGCCGACACACTGGAGCCGCGCCCGTCATCGCAGGGACTCGTCGGCCAAGAGAAGGCCCGGAAAGCGGCAGC
CGTTATTTTGGAGATGATAAAACAGGGCAAGATTGCCGGCCGGGCCGTCCTCATCGCCGGTCCTCCCAGGTAAGCAGCAG
CAGTTCTCTTGCTCTTGACTTTTCCTCTGTGCTCCTGCTGACGCGCCTGCTCAGCACGGGAAAGACTGCTATCGCCACGG
GCATGGCCCAGTCTCTGGGTGCCGACGTGCCGTTCACATCCTTGGCCGCGTCCGAAATTTTCTCCCTCGAAATGTCCAAG
ACGGAGGCGCTCACCCAGGCGTTCCGGAAGTCGATCGGCATCCGCATCAAGGAGGAGAGCGAGATCATGGAGGGCGAGGT
GGTGGAGATCCAGATCGACCGCAGCGTGACAGGCGGTGCCAAGCAGGGCAAGCTGACGATCAAGACAACCGACATGGAGG
CCATCTATGACATGGGAAGCAAGATGATCGACGCCATGACCAAGGAGCGTGTCATGGCCGGCGACATCATATCCATCGAC
AAGTCGTCGGGGAAGATCACGAAACTGGGCCGCTCCTACGCGCGGTCCCGCGACTACGACGCCATGGGCGTCGACACAAA
GTTTCTGCAGTGCCCTGAGGGTGAGCTGCAGAAGCGCAAGGAGGTCGTGCACACGGTGACGCTGCACGAGATCGACGTGA
TCAACTCGCGCACTCAGGGCTTCCTGGCCCTCTTCTCGGGCGACACAGGCGAGATCCGCAGCGAGATTCGCGACCAGATC
AACACCAAGGTGGCCGAATGGAAGGAGGAGGGCAAGGCCGAGATTGTTCCCGGTGTCCTGTTCATCGATGAGGTGCACAT
GCTGGACATCGAGTGCTTCTCGTACATCAACCGTGCCCTGGAGGTCGACCTAGCGCCCATTGTGATCATGGCCAGCAACC
GCGGCCAATCGCGCATCCGGGGCACCGACTACAAGAGTCCGCACGGGCTACCGCTGGACTTTCTGGACCGCATCTCAATC
ATCACCACGCACGCATACGGCCCAGAGGAGATCAACAAGATCCTCTCGATCCGGGCACAGGAGGAGGAGGTGGAGCTGAC
GCCCGATGCGCTGGCTCTGCTGACCAAGATCGGCCAGGAGACCGGCCTCCGCTACGCGAGCAATTTGATCACGACGTCGC
AGCTGGTCAGCGCGAAGCGGCGCGCAAAGCAGGTGGCAGTGGAGGATGTGCGGCGCAGCTACCGGTTGTTCTACGACGCG
GCGCGGAGTGTCAAGTTTGTGAACGAGTCGGAGAAGCGGCTGATCGGCAACGACGGCAGCATCGACTTTACCGTGGCGAA
TGGCCAGGGAGATAGAATGGATATCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62