GenePrediction:GLEAN_4851 Details

Name: GLEAN_4851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1021701..1019904 (- strand)
Length: 1798
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1021701..1021023 (- strand)
Length: 679
Type: CDS
Source: GLEAN
Position: GCSC_89:1020963..1020176 (- strand)
Length: 788
Type: CDS
Source: GLEAN
Position: GCSC_89:1020104..1019904 (- strand)
Length: 201
>GLEAN_4851 class=GenePrediction position=GCSC_89:1021701..1019904 (- strand)
ATGTCGAGCCGTGTCAGCCGGAACACGTTTGAGGACCGCGAGTATCTCGCGCCCGGTGCCCGTCCACGGCCGCGTTCCGA
GGCGGGCTACTATGATCGGCGTGAAGAACGTCAACCGGAGTTCCGAAGCCCATCTCGTGGCGGACGGATGCGCGAGGTCG
ACCAGGTCGATGTGCGTGTCCGCGAGCGCTCACGCGAGCGGGAGCGGGACCGAGACCCGTTTGCTCGATACCATGAAGAT
CGTCGTGCCGAGAACGGCGCCATGGTGCTTCGCCAGCGGGAAATCGAGACGGTTGAGCGCGAGCGGCCTCGAGCACGAGC
AGCTTCGCCGGCTTCTGTGCGCATCATCCGCCGGCGCTCAATGTCTCGCTCGCCGTCACCTCCGGAGCGAGAAATGAACC
GGGTCGAGATTCGCGACCGTGTCAATGACCGTGAGCGAGACCGGTATCGCGCTCCGGAAGAGGAGCGAGTCGTCACCCGC
ATTGTGCAGAGGGAGCGTGAGCGCACGCCCTCGTCGTCGCCCGAGCCGCGAGAGCGCATCCGCATCTTCGAGCAGACCCG
GTCTCGCGCTCCTTCGCCCAGCCCATCGCCGCCTCCTGCTCCAGTAGCAGCTCCTCCGGTCATCCGGGGTCCCGTGGTCG
AGCGCGAGGTCATCACCCACTACACGGACGTCGATCACGGTATGTGTCATCTTGTGCTGCCAACACCCTACATCCGGATG
CTGTGCTGACGTGTCAAGGTGTCGTCTATGCGCCGCTTGTTCCACCGCCTCCGGCGGCTGAGCCGGCACGCCGGCGTGAC
GTGGACATTGACGTCTTCACGTCGCACAATGAAACCCGCGTGGACATTTCCGAGAAGAAGCCGCGTGAGCGTCGCTCGTC
GCGGCCGCCCCCGCCTTCGAGCCAGAGAGGCTCCCGAGGCGAGCTCGTCGTGCAGTCCGAACGCAACCGGCTGGAGATTG
ACTATGACGATCGCCGGCCCAACCGTTCTCACTCGGCCGCGCCGCCACGCCCATCACGCTACTCTGACGAGGTCGATGAC
GAGGCTGACTACGTCGAGTCGCGCATCGACGAGCGTGGCCGCATGGGCGAGGCTCGCAACGGTGCCACCCAGGAGTGGTC
CATCATCGACGTGCCGCCCGGAACGGAGCGTGTCCGCTTGGACGGCGCTGGTGGTGGCGCTGCTGAAGTTACTTGGCAGC
GCTATAACGGCGTGAGACGCACGCGCTTCATCCCGGACCGCCAGGATGACGCAACGCCCGGACGGCGTGACCGTGATCGT
GACCGTGACCGCGAACGCGACCGCAGCAACATCAACGTGCAGATCCTAGACAACGGCCGCCATCGCGACCGCGAAATTGA
CATCCAGCAGGTCAACGACGATCGCGTCATGGTGCGTGCACCTCAGCGCGACGATATGTGGACCGAGATCACCAAGGATC
TCGTCAACAGAGAGGCCATTGAGCGCCTCAACTACAAGTACACCGAGACGGACTACTTTTTCTACATTCTCGAGTACCTA
CACCATGTACGTTTTTGTCTTTACCTTTTTGTCCCTTTCCCCTTCTCCTGTTAATACATTGCACTCACACACAACAGGAC
GACGTCCAGAAGCTCGTGAAGCTGACTGAGCGCATCCGGCGCAACCGGCGGCACACTCGGCCGTACTCTCGTGACGAGAT
CGACATTGATGTGCGCCAACGGAAACGCAGCCGCAGCCGTCCGCGACGCCGCCACGACGACGTGCGTGAGCAGGAGATCA
TTGTAGACCACCAGCCTGCGCGCACCTATTACCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62