GenePrediction:GLEAN_4852 Details

Name: GLEAN_4852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1017552..1016794 (- strand)
Length: 759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1017552..1017316 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_89:1017257..1017199 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_89:1017127..1016794 (- strand)
Length: 334
>GLEAN_4852 class=GenePrediction position=GCSC_89:1017552..1016794 (- strand)
ATGGCCAACCCCCGTGTCGAGGAGCTCCCGGACGACGAGACCAAGAATGTCCAGGTCGAGGAGCAGGAGGAGGAGGATGA
CAGCTCTGCCGAGTCGGAGATCGAGGTTGCCCCCCCCGCCGGCTCCACCACGGTCGTCCACTCCCGCAACGAGAAGAAGG
CCCGGAAAGCCCTGGAGAAGCTGCACCTGATCCGCGTTGAGGGCATCACCCGTGTGACCCTCCGCCGGCCCAAGAACGTG
AGTCGCTATTAATTGCCGGCCGCCAGAGGAAGCCTGTCACTAACAGACGACCCAGGTCCTCTTCGTGATCAACAACCCGG
AGGTGTACAAGTCCCCTAACAGCGGCACCTACATGTAAGTACAGGAGGCCGAGGGCGAGATGCTGCGTGAACGTGGACGT
GCGTGGCTGACATTGGACGCTGCAGTGTCTTCGGTGAGGCCAAGGTGGAGGACCTCAACGCCACGGCCCAGGCCGCGGCT
GCCCAGCAGCTGGCCAGCCACGATCACGACCACGACCACGCTGGCCACGACCACGACCACGACCACGATCATGACCACGA
TCACGGCGCCGAGGGTGGCGACGAGAAGAAGGAGGAGGAGGAGGAGGATGAGGAGGAAGAGGTCGATGCCACCGGCATCG
AGGACAAGGACATTGAGCTGGTCCAGACCCAGGCCGGTGTGTCCCGCAACAAGGCCATCAAGGCTTTGAAAGAAAACGAC
AATGACATTGTCAACTCGATCATGTCGCTGAGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62