GenePrediction:GLEAN_4853 Details

Name: GLEAN_4853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1016117..1015387 (- strand)
Length: 731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1016117..1016109 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_89:1015978..1015496 (- strand)
Length: 483
Type: CDS
Source: GLEAN
Position: GCSC_89:1015416..1015387 (- strand)
Length: 30
>GLEAN_4853 class=GenePrediction position=GCSC_89:1016117..1015387 (- strand)
ATGGCCGCTGTGAGTTTCTGACGGCCATTCCTGCTCGACGGTCGTGGGAGGAGCCGACGCAATGGAAGGATACGAGGGCG
ATAGGGCGGCCGTTGTGCCGAGCGAAGCACAGATGAGCTAATTTTCCTTTTGTCCACAGAAATCCGCCGCCCTCAAGCTC
GACTGGGCCAAGGTGACGACGTCGCTCGGCCTGCGCGGCCAGACGGTGTCCTCGCTGCAGGCATTCAAGAAGCGCAGTGA
CGATGTGCGGCGCAAGGTGCAGACGCTGTCAGAGCAGCCGACGACGGTCGACTTTGCGCACTACCGCAGCGTGCTGAAGA
ACACGGCCGTCGTGGACGAGATCGAGAAGCGGTTCGCCGCCTTCAAGCCGGTCACCTACGACGTCAACCGGCAGCTCAAG
GCCATTGCCGCCTTTGAGGTCGAGGCCATCCGCAACGCCGAGGCCACCAAGGAAAAGGTCGACCTCGAGCTCAAGGACCT
CGCCAAGACGCTCCAGAACATCGACGAGGCCCGGCCGTTTGCCGACCTCACCGTCGACGACGTCGCCGCCGCGGAGCCGT
CCATCGACGAGAAGACCGCCAAGCTCGTCTCCAAGGGCCGCTGGGCCGTCCCCGGCTACAAGGTCAGTCCTCCGGTGATC
CGGCCGAGCCCGAGTCCGCTCGCGCCCAGACGCGTCTGTGCAGTGCTGACACCTCGAACAGGAGAGATTCGGTGACCTGT
CCATGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62