GenePrediction:GLEAN_4854 Details

Name: GLEAN_4854
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:1001310..998831 (- strand)
Length: 2480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:1001310..1000729 (- strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_89:1000678..998831 (- strand)
Length: 1848
>GLEAN_4854 class=GenePrediction position=GCSC_89:1001310..998831 (- strand)
ATGGCCGGCCTCTTCAACTTCCGTCGGAGGCATGAGCCTGGCGAGATACAGCCGGAGATTCTCCCCGCCACCAGCGGGGC
TTACGGCGTGGAAGAGGACAACATCCAGGCGGCCACGGGCTCGGACGCGCTCAACACGCTCAAGCAATTCAAGAACCTGC
ACCAATTCGATCCCAATTTGCCAATCGAGGAGCTCAACGACATTGACGATGCGCTGCAGAGCGGCAATGCTGAGAAGGGG
CTGCAGATGGAGCAGGTCATCGTCGAGGACAACTCGCCGTACGCCGAGGTGCGCGCGTCTGTCCGCAACTACGACGTCGA
CCTGCCGGCCAACACGATCCGCGCCTGGGTGATTGGGATGGTTCTCTGCACCGTCGGCTCCGGCGTCAACATGCTCTTCT
CGCTGCGCAACCCCAGCGTCACGGTGACGACGTACGTGATCCAGCTGGTGGCGTACCCCATCGGCCTGCTCTGGGACGTC
GTCTTCCCCGACCGCGTTTGGAGCCTCTGCGGACTCAAGTTCAACCTGAAGCCGGGCCCGTTCAACTTTAAGGAGCACGT
GATCATCGTGGTCATGTCCAATGTGAGTGCTCTCCCCCTGTCTCTGCTTCCGTCTCCGTACTGACCGGGCAGGCTGCCTA
TGGTGGTGGTGCTCTCTATGCCACGGACGTCATCATTGCCCAGGAAAAGTGGTACCACCAATACTTTGGCTGGGGCTGGC
AGATCCTGTTCGGCATCACCACGCTCTGCACGGGCTACGGTATTGCCGGGCTGTCGCGTCGCTTCCTCGTGTGGCCGGCG
GCCATGATCTGGCCCAGCGACCTGGTCAATGCAGCGCTCTTCTACACGCTGCACGACCACTCGCCGTCTGACCCGGCCCA
CACCAACGGATGGCGGGTCGGGCGCTACCGCTGGTTCATGATCGTGTTCGTGCTGGCCTTTGTGTGGTACTGGTTCCCCG
GCTGGATCTTCCAGGGTTTGAGCTGGTTCTGCTGGCTCACATGGATCTGGCCCAAGAGCAAGGTGGTCAACCAGGTGTTT
GGCGGCCTTAGTGGCTACGGCCTGATGCCGATGACGCTTGACTGGACGATCGTGTCAGGCTATCTTGGCTCGCCGCTGAT
CCCGCCGTTCCATGCCATTGCCAACTCGCTCTTCGGCATCATCTTGTTCTTCGTTGTCGTCTCGTCGGGCCTGCACTTTA
GCAACGTGTGGGACAGCGGCTATCTGCCGGTGCAAAGTTCTAGCGCCTTTGCCAACACCGGCCACAAGTACAACGTGACA
GAGATTCTGACCGACCTGAAGTTCGACGAGGCCAAGTACAAGGCCTACTCGCCGCTCTTCCTCTCGACGCAGTTTGCCCT
TACGTACGGCCTGTCGTTTGCGGCCGTTGCGTCCGTGGTGGTGCACGTGGTGCTGTACCACGGCCAGGAGATCTGGTCGC
AGTTCCGGCTTGCGCGCCACCAGGAGGACGACGTGCACATGCGGCTGATGAAGAAGTACCGCGACGCGGAGGACTGGTGG
TACGCGGTGCTCTTTGTCATTATGATCGGCCTCTCCTTTGCCGTCGTCTGTGGCTGGCCAACCGACTTCCCTTGGTGGGG
CTACATTGTGTGCATGATTCTGCCGCTGGTGTGGACGATTCCGATTGGCATCATCCAGGCCATCACCAACATCCAGCTGG
GGCTGAACGTGCTGACCGAGTTCATCGTCGGTTACATGCTTCCGGGCCGGCCGCTAGCGATGATGATGTTCAAGAACTAC
GGCTACCTCTGCATGTCGCAGGCGCTGTACTTTGCCCAGGACCTGAAGCTGGGCCACTACATGAAGGTGCCGCCTCGCAC
TATGTTCTGGGCGCAGTTGGCGGCGTCGATCTGGTCTGCGATTGTGCAGATTGCGGTCATGAACTGGGCGCTGGGATCGA
TCCACGACGTCTGCTCGGACGATCAGAAGAACTCGTACACGTGCGCCAACGCGAAGGTGTTTTACACCGCTTCAGTCATT
TGGGGTGCTATCGGTCCCAAGCGCATGTTCAGCGGCGACGCCATCTACCACAAGCTGCAGTACTTCTGGCTGGTCGGCGC
CATCACGCCCATCATTACCTGGTTCCTGGCGCGCCGGTACCCCAAGTCGGTCTGGCGCTACGTCAACATGCCGCTCATCT
TTGGCGGCCCCGGTTGGCTGCCGCCCGCCACCGTGTTCATCTACCTCTGCTGGGGCAGCGTGGGCACGTTCTTCAACTGG
TTCGTCAAGCGGAGGTGGTCTGGCTGGTGGATGCAGTACAACTACGTCACGTCGGCTGGTCTGGACAGCGGCCTGATCGT
GTCTACCCTGATCATCTTCTTCAGCCTGTACCTCACCTCGGCCACGGCGCCGCAGTGGTTCGGCAACGTCGGTGCCCTCG
AAACGCTCGACATGAAGGGAAAGGCTCTACACCTCGAGCTTCCTGCGGGCCAGAAGTTTGGCCCGTCCAATTGGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62