GenePrediction:GLEAN_485 Details

Name: GLEAN_485
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:126830..128095 (+ strand)
Length: 1266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:126830..126832 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_97:126893..127195 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_97:127259..128095 (+ strand)
Length: 837
>GLEAN_485 class=GenePrediction position=GCSC_97:126830..128095 (+ strand)
ATGGTATGGAGCTCTTCACACGAAGATGAGGCGTATGCAAGCAGCTGACACAGTTTGCGGCAGTTTGTTCCTAACTACGG
ATTCGATCCTCATAATCCCCACCGGGGAGCGCGCGGCGCCATGTCGATGCGCTTCGACGAGTTCTACCGCTGTTATCCCA
TGGTTATGGCGCCCGGGAGTGAGCGACCCGAACTCAACTACGGCTCCAAGATTCTGCTTCCGCCGTCGGCGTTGGATAAG
GTATCCCGGTTACACGTTCAGTGGCCGCTCCTAATGGAGCTGGTGAATGCAGAGAAGGGGAAGCACTCGCATTGTGGTGT
GCTCGAGTTTGTTGCCGAAGAGGGCCGGGCGTATCTGCCACAATGGGTAAGCACCAAGAATGCAGCTGGGAGAATCGGAA
ATGGGCGCTGCTGATATTGTCTATCCTAGATGATGGAAACACTACGTTTGGATGTCGGCGACATGATCCAGATCAAGACG
ACATCGTTGGAGCTGGCACGCATGGTGAAGCTACAGCCACAGTCGCCGGCCTTCCTCGAGATTAGCGATCCCAAGGCCGT
CCTTGAACGGGCATTCCGCAACTTCGCTTCGCTGACCAAGGGCGATATTTTCAACTTCGAATACAACGGAGACGTCTACG
GCGTGGCGGTTCTGGAAGTCAAGCCCGAGTCAGAAAAGATGGGCGTCAGCATGCTAGAAACAGACGTGTCGGTGGAATTC
GAGGCGCCAGTCGGTTACGTCGAACCAGAACGTGTCAAGGGCAGCGGAACTGGAACACCAAGAAACGGACTAGCACCTCC
AGGCGGTGTCCTACACAATCAGGGAACCATGGCGCAAGCAATCAACTACGAGTCTATCGCACCTGGGACAGAGGCTCTGA
AAGCGTCCAACTTTTCGGGCGATGGTCATAGAATAGGAACGAAGAAGGGGAAGGCCGTGGCTACCACATCAGGGAAGTCG
TCCTCAACAGGAACCGGGACGCCAAAAATGGCTGCAGAAGCTGCTTTGGGCACGGCACGTCGAGCCAACGGGCCCATGCC
TCTCCGACTGCCACCAAACAAGCTCTTTTTTGGCTATAACGTCCGGCCGGTGAAGACAAAGGAGCAGAAAGAGGAGGAGG
CAGCAGGAGCCTCGAATCAGCCACACTTTGCTGGCCAAGGACAAAGCCTCCGTGATGCGGCAACAAAGAAGAAGGCCGGA
GATGATGGTACATCCAAGTCCAAAGACAAGAAGCCAGGGAAGTCAAGCGGGCGGAAACCACTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62