GenePrediction:GLEAN_4863 Details

Name: GLEAN_4863
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:916769..911783 (- strand)
Length: 4987
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:916769..916143 (- strand)
Length: 627
Type: CDS
Source: GLEAN
Position: GCSC_89:916089..912848 (- strand)
Length: 3242
Type: CDS
Source: GLEAN
Position: GCSC_89:912785..911783 (- strand)
Length: 1003
>GLEAN_4863 class=GenePrediction position=GCSC_89:916769..911783 (- strand)
ATGGCATCATTAGACCCAGAGGCCGCTTCGGCCGGAGCGCAGCATGACCGACTGAGTGTAAGCGGCGCGCCTGGTGATGT
GTCCGATGCGCCCACCGAAGCTGGCAACAGCAGCGCTGCTGGTAGGCACAGTAAGATCTCAATTGCCGACAGCCTGCCGA
TTCCTCCGACGCCACCGATACCAACCGGTCCGACCCCCAAAAAAGCAGCGTCCAAAACGAAGCGGTCTCGATGGGCCACG
CGCAAGATGACGATTAAGAGCAGCAACAAGAAGCGCATGTCCATCATCGGACGCGCGAACAACAAGTCAACTGCTCACGA
CAAACGTATCTCTGCTGGTTCTGGGACTCTCCGCCACGACGACGACGACGGAGAGGCCGACGACGACGACGACGCCCCAG
ATGCCCCAGATGACCAGGAGCACGATGGCCCCGGCCCGAGAAACCTGTACTTCAATATCCCTCTGCCCGAGGACCAGAAG
GACGAGGATGGCCTGCCAGTCCAGTCGTATGCGCGGAACAAGATCCGGACCGCAAAGTACACGCCCCTGTCTTTTGTTCC
CAAGAATTTGTACTGGCAATTCCAGGCCATTGCCAACATGTTCTTCCTCTTCCTCGTCATTCTCACTGTAAGCGCACAGC
GGCCTCCTCTGCTTCATTGGCTGCATTCTAATCTGGCTAGATTTTCCCCATTTTCGGTGGTTCGAATCCGGGACTGAACG
CCGTTCCTTTGATAGCAATTGTCGTGATCACTGCTATCCGAGATGCTGTCGAAGATGTTCGCCGAACCCTTTCGGATAAG
ACTTTGAACAACTCGCCTGTGTACCGCCTTGTGGGATATGATAACGTCAATGTACGCGAGGATAGCGTATCGCCTTGGCG
CAAAGTGAAGAAGGCTACTTCGCGCTTCATCTCGGCCATGTGGCACTCGACGGAACGCTTGTGGAAGAAGGATACCAAGA
AGAACAGGCCTGTCTCCTTCGGCAATGAGAACGATCCGCGCATGTCCATCGAGACTCGCCGTACGCGTCCTGAGACCATG
CTGTCTCCGTATACCGACCGCACATCATACGTATCTGCCCACGAGGATATTCCGATGACGCCTGTGCCGTCTCCGTCACC
ACGCCACCCGCCAGCACAGATGCAGGACATGCTATCTCCGGGGCAAGACGCCAACGCCAACCGCCCGATCTCTGCGTTCT
CCTTCGTACCCGGCAAGGACGGCAAGGAGGCTTTTAACTTGCGCAATGTTACGACTGATGTGATCAACCACGACCTCATC
CCGACTGGCGATGCTCGCTTTCACCGCAGTGCCTGGAAGGACCTACAAGTGGGCGACTATGTGCGTATTTTCAACGACGA
CGAATTGCCCGCCGATGTTGTCATTCTTGCTACCTCTGATCCGGATGGCGCCTGCTATATCGAAACCAAGAACTTGGATG
GCGAGACGAACCTGAAATTCCGCCAGGCCCTCCGCTGTGGTCGCAACATCAAGCACGCGCGTGACTGTGAACGTGCTCAG
TTTTACATTGAAAGCGAACCGCCGCATGCCAACCTGTACAAGTACAGTGGGGCTATTCGCTGGTCCCAGCAGTTCGAAAA
CGACCCGCTTGGGAAGCCTCGCGAGATGTCCGAGCCAATTACCATTGACAATGTTCTGCTGCGCGGCTGCAACCTGCGAA
ACACCGAGTGGGCTTTGGGCGTCGTCTTGTTTACTGGACATGACACCAAGATCATGATGAACGCTGGCGAGACTCCTAGT
AAGCGCGCCCGTGTTGCTCGTGAGCTGAACTTCAACGTCATTTGCAATTTCGTTGTGCTCTTCGTCATCTGCCTGGTTGC
CGCCATCGACAACGGCGTCTCATGGGCCAAGACGGACGCCTCGCTGAACTTTTTCGACATGGGCCCATATGGAGGTACTG
CGCCTCTGGCCGGTTTCGTTACGTTCTGGGCTGCTGTCATTCTGTTCCAGAACTTGGTGCCTATCTCGCTGTACATCTCG
CTGGAAATCGTCCGAACGCTGCAAGCGGTATTTATTTACAGCGATGTGGAGATGTACTACGACGTGATCGACCAGCCCTG
CATTCCCAAGTCATGGAACATTTCCGACGACGTCGGCCAGATCGAGTACATCTTTTCGGACAAGACCGGCACCTTGACTC
AAAACGTTATGGAATTTAAAAAGGCAACCATTAACGGCCAGCCGTACGGCGAGGCATATACTGAAGCCCAGGCTGGTATG
CGGAAGCGTCTGGGTATTGACGTGGTTGCGGAAGCTGCACGCGCCCGCGCCGATATTGCTGATGCCAAGGTTCGTGCATT
GGCTGGACTCCGGTCGCTGCACGACAACCCATTCCTACACGACGAGGATGTGACTTTCATTGCTCCCGATTTCGTCGACG
ATATCTCCGGCAAGCACGGCCCTGAGCAGCAGGCGGCGAATGAGCGCTTCATGCTTGCCCTCGCTCTCTGCCACACTGTC
CTCTCTGAGAAGCAACCCGGATCTCCGCCTCGCATTATTTTCAAGGCACAGTCGCCCGACGAGGCTGCTCTGGTTTCCAC
GGCTCGCGATATGGGCTTCACCGTCCTCGGCAACACTGGCGATGGCATCCGGCTGAACGTCATGGGCGAGGAGCGCTACT
ATCCTGTATTGACGACGATCGAGTTCAATTCGACGCGTAAGCGGATGACGGCTATCGTGCGGATGCCAGACAACCAAATT
GTGCTTTTCTGCAAGGGCGCCGACAGTATCATCTACTCCCGACTCAAGCGCGGCGAGCAGGCCGAGTTACGCAAGACCAC
GGCTGAACACCTGGAAATGTTTGCGCGCGAGGGTCTGCGTACTCTCTGCATTGCACAACGGATCCTGACCGAGGAAGAAT
ACTATGCTTGGCGCAAGATTCACGACGCTGCCGCCACTGCCCTCGACGACCGCGAGGAGAAGATGGAAGAGGCGGCGGAG
CTGATTGAACAGGATCTGTCTCTGATTGGTGGCACGGCCATCGAGGACCGTCTGCAGGACGGCGTCCCCGACACGATTGC
GCTGCTGGCTGAGGCTGGTATCAAGCTTTGGGTTCTGACTGGTGACAAGGTGGAGACGGCTATCAACATTGGTTTCTCGT
GCAACCTGCTGAACAACGACATGGAGCTGATCCATCTCAAGGTGGACGAGGACGAGTCCGGCAAGACACTAGACGGCGAG
TTCATGAAGCAAGTGGAGGCCGAACTAGACCGCTACCTGCAGATTTTCAATATGACGGGTGGCGCTGAGGACCTGGCGGC
GGCAAAGGCAAATCACGAGCCGCCAGCACCGACCCACGCGATCGTGATTGACGGTTTTACGTTGCGGTGGGTGCTGTCTG
ACAGCCTGAGCCAGAAGTTCCTGCTGCTGTGCAAGCAGTGCAAGTCTGTGCTCTGCTGTCGTGTCAGTCCGGCGCAGAAG
GCGGCCGTTTGTGGCTTGGTCAAGAACGGTCTCGACGTGATGACGCTGTCTATCGGTGACGGAGCCAACGACGTGGCTAT
GATCCAGGAGGCCGACGTCGGCGTGGGTATCGCCGGTGTGGAAGGCCGTCAAGCCGTCATGTCCTCGGACTATGCTATCG
GACAGTTCCGCTTCCTGCAGCGGCTGGTGCTGGTTCACGGACGCTGGTCCTACCGGCGGATGGGCGAGGCGATTGCCAAC
TTCTTCTACAAGAACATCATCTGGGTGTTCTCCATCTTCTGGTTTCAGATCTACTGCAACTTCGACATGACATATGTCTT
CGACTACACGTACATTCTGATGTTCAACCTTTTCTTCACGTCGGTGCCGGTCATCCTTATGGGCGTGCTGGACCAGGACG
TGTCGGATGCGGTCTCTCTCGCGGTGCCGCAGCTGTATCGACGAGGCATCGAGCGGCTCGAGTGGACGCAGAAGAAGTTC
TGGTACGTGGCTCTCTCCCGTGGCTGCTGTATCGTGGGTTCGACGGTGTGCTAACGATTCCCAGGCTATACATGATCGAT
GGCGTGTACCAGTCGGTTCTCTGCTTCTTCATTCCCTACCTGACGCTGTCTCGCACGACGTCTGGCGCGTTTAACGGAAT
GGACGTGTCGTCCCGTCTGCAGCTGGGTGCCTACATTGCGCATCCGACCGTGTTCACGATCAACATGTACATTCTGATCA
ACACGTACCGCTGGGACTGGCTGATGCTGCTGGTTGTGAGCCTGAGTGACCTCTTCGTCTTCTTCTGGACCGGTGTGTAC
TCGTCCACATCGTACGCCGAGTACTTTTACAAAACGGCACCGCAGATTTACGGACAGGCAACGTTTTGGGCGGTGTTTTT
CATCACGCCGATCATGTGTCTGTTCCCGCGCTATGCTCTGAAGGCGGTACAGAAGGTGTACTTCCCGTACGACGTCGATA
TCATCCGCGAACAGGTGCAGATGGGCATGTTCAAGGACGTGGAGCGGACACATGGCGGCGGCAAGATGGACGCGACAGAT
GCGGCAGAGAAGGCGGTTGATGGCAGCGCATCGACCGGTGGCTCCTCGTCCGAAGGATCGCGCAAGACTAAGAAGCCGAC
GCATACGGCATACGCCAGCGTGGACGAGGACCGACGTCCGATCTACCCGCCATCGGTGGCGACGCACAACACGCGGACGC
AGAACGGCAGCGACGACACGAACTACAGCGGGCGGCACGGACGGCTGTCGTCAATCGACGACATGAGCCCGGCGATGCCG
GTGACGTCCAACGAGCTGGGACGGCAACGGCAGTCGATCGACCGTGCTCGGCCGTCGTATGACCGGATGCGGATGTCGAT
GGACCGGGTGCGGCCCAGCTTCGAGGCCAGCAACGAGTTCACGTCGGCAAAGCGGCTGTCGATGCTGGAGGGCAGTATCT
CGGCGGGCGGGGACGGCAGCAACATAGCCAGTGGCAGCGGCACGGCAGCAGGCCGGTTTATCCAGGGCCGTCTCCGCGGG
CTCTCTATCAAGGGCAAGCAGAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62