GenePrediction:GLEAN_4866 Details

Name: GLEAN_4866
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:890875..889061 (- strand)
Length: 1815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:890875..890480 (- strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_89:890311..889061 (- strand)
Length: 1251
>GLEAN_4866 class=GenePrediction position=GCSC_89:890875..889061 (- strand)
ATGAAGCGCTTCATCACCCTCTCTCTGGCGGCGTACGCCTACGCCGCGCCTGCCATCAACACTGAGACCATCCACGGTGA
TGCTGCTCCGATTCTGTCATCGACAGGAGCTGTGGACATCCCAGGCGCCTACATCATCAAGTTCAAGAACAATGTCAACG
GAAAGAAGGCCGCAGACCATCACACGTGGGTGCAGTCCATCCACTCAGACTGGGTGAAGTCCTTCCCGGAGGGCGACGAG
GAGCGCAACCTCGAGCTGCGCAAGCGCGGCGTATTGCCAGTGGCAGACTCGCTCTTCCGCGGTCTCAAGCACACCTACAA
CATTGGGGATGAGTTTCTCGGCTATGCAGGCCATTTCGATGATTCTATCATCGAGCTGGTCCGCCGGCATCCGGATGTAA
GTAGACCAGCCCCCTTCGATGTCATTTTCACATTATCGTCCGTGAGATGAACAGAGCTAGAGCTCTCCTTATCTCTAAAT
GGGGCGGCCTTTCGGCGATAAGGCAGCAGGCTATCACGCGACTCCAACAAGTCCACCCGTGCTAACCATAATGCTACCTA
ACAGGTCGAGTACATCCACCGCGACACTGTCGTCCACACGATGAAGTATGAGGAGGTTGGCACTGAGAAGTGCAGCCCAG
AGACGGAGAAGGGTGCCCCCTGGGGTCTGGCCCGTCTCTCCCACCGCAAGTCGCTGAACTTTGGTACCTTTAACAAGTAC
CTGTTCACCGAGGAGGGTGGCGAGGGTGTCGATGCCTACGTTATCGACACCGGTACTTCGATCAAGCACATTGACTTTGA
GGGCCGCGCCCATTGGGGCAAGACCATTCCTTCTGGTGATGAGGACGCTGATGGCAACGGTCACGGAACTCACTGCTCTG
GTACCATCGCCGGCAAGAAGTACGGTGTTGCCAAGAAGGCCAAAGTCTACGCTGTCAAGGTTCTCCGCTCCAACGGCTCT
GGCACCATGTCGGATGTCATTGCTGGCGTCGAGTTTGCTGCCAAGCGCCATCTCGACCAGGTTGCACTCGCCAAGAAGGG
CAAGCGCAAGGGCTTCAAGGGTTCTGTCGCCAACATGTCTCTGGGCGGTGGCAAGACGACGCCGCTGGACGCCGCCGTCA
ACGCTGCTGTCTCTGCTGGTCTGCACTTTGCTGTCGCTGCCGGTAACGACAACGCTGATGCTTGCAACTACTCCCCTGCT
GCTGCTGACAAGGCCCTCACCGTCGGTGCCTCTGCCATTGATGACAGCCGTGCCTACTTCTCCAACTGGGGCAAGTGCAC
TGATGTCTTCGCCCCTGGCTTGAACATCCAGTCCACCTGGATTGGCAGCGAGACCGCCATCAACACCATCTCTGGTACCT
CCATGGCCTCGCCGCACATTGCCGGTCTGCTGGCCTACTACCTGTCTCTTCAGCCTGCGGCCGAGTCCGAGTATTCTGTT
GCTCCCATCAGCCCCGAGAAGCTCAAGTCCAACCTGCTGGCTGTGGCCACGACCGGCGCCCTCACCGACCTGCCCGCCAA
CACCCCCAACCTGCTTGCCTGGAACGGTGGCGGTTGCGGCAACTACTCTTCCATCGTCGAGCGTGGCAGCTATGATGCCG
CTGCTGACAAAAAGACCGAGGAGCCTGAGGCCGCTGATGTTCTCGGCGCTGTCTCGGACCTCGAGAAGGCCATTGAGCTT
GACCTGAAGATTGTCTCCGGCAAGGCCCTTGGCGGTGCCTCGGCCTTTGGCCGCAAGGCTGAGAAGTTCTCCAAGAAGAT
CCACGAGCTGGTCGACGAGGAGCTGAAGGAGTTCCTCGGCGAGGCCTCTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62