GenePrediction:GLEAN_4867 Details

Name: GLEAN_4867
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:883913..880080 (- strand)
Length: 3834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:883913..883699 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_89:883596..880080 (- strand)
Length: 3517
>GLEAN_4867 class=GenePrediction position=GCSC_89:883913..880080 (- strand)
ATGCAGGCCATCCAGCAGCGATGCCGGCCAAAACACCAGGTCTTGGTCCTCAAGTGCTATCCGCGAACCACTAAGGGTGC
GGTCGATGTGAAGCCCAACTCGAGCGAGCTGAGCTATCTGCTCTACTATGCCACCTCACGGCGAACCAAGATCCAGAAGG
TCGGTAGCTTTCTCGAGCGGAAGACGGCAAGCGATGTCTGGCACCTGCGCATCGGGTACGTTTTTCGTCCTTTCTTTCTC
GACGGGGCCTGATATGGAGAGATCGGCAGTCTCCAGAGGAGTCCGTGTTCAAACTAATATTCCCCCGCACCCGACAGAAA
TGTCCAGGTCACCCTTCAGATACTGGAAGCTCTGATCGAGAAGAACCCCAAAGATCTCCCGCTGTTTGCGCCCAACATCC
TAACGATCCTCGATCTCATCCTACGATCCAATGACATCACCATGGTCGAATCCTCGATTCCCACATTCAAGGCTTTCTGC
ACGCACCACGACGCGTCTATCCTGTTAGCTGATCAGGCCTACCTGGCCCAGTTCGAGGCCGTCGTGCGTCATTATGCCTC
TTTTGCCTCCACGCGACTTGCTCCCGGGAAGACGCAGCCCAGCAAGCCGGTGACGATGCGATGGCGCAACTCGGGTCTCG
AAGCGATCCGCGCCGTGGCGTCATCGGATGCACTCTCGTCCATTGCCGGCCGCCAGTACGACATGATGGTGCCGATGGTT
CTGGAGAATCTGTGGACTGACAACGAAGACTTCCTCGATGTGCTGTTGCAGCGCGTCGAGGTCGAGGAGCAGGTCGACAC
AGATCGGCTGCTCAAGCGCCGAACTAGTGTAGCTACCGTCCGCACGGCAGACATCGCTGGCGACACAAATCCAATTGCCC
TGTCCGGCACGGCTACGGATGTGGACAAGCTGGCCGAGGAGGACATTGGCGTTCTTGCCATGCAGTGCTTGAAGCAGATT
TTCATCGCCCCGAGCCGCTCGTTGATCCACTCGGCTACCACATCCTTGCTGGAATTTGTCAACGACCGGATCAGCCAGGG
CGAGTCCGTCGTGAGTGGCAACTTCAACAGTGGCAAGGACAATGGCTGGGCCGTCAAGATCTGCAGCCTCCTTCTCCGCT
GGGCTCCGGTTCAAGAGCGATACATTATCCTCGTCACCACCATAGACACCCTAGCACGCTCCCCGCTCACCGACGAGACC
CTTGATCAGCATATCACCCTAGCCGCCATGATTGCTTCTCTGCTGCGGTCGGATGCAAGCTTGATCGGCCTGAGCGTCAT
GGATGTGCTGCTTAGCTTCATCCATCACATCAAGAAGCTGGTGCAGATGCCAGGCGACCCTGCTGCTGCCGCTGCTCTGG
CCACGTCTGAAGGCCCGCTGCCAGGCCAACAAGACCTGCGCTCTCCGACCACGCAGGCAGCGGCCAGCTCGGCAGTGACT
GTGTCATCGAAGCGTAAGGAGCTTCTACTTCGCCTGCAGCAGTGTATTGGCGATCTGGCTACCCACGTGTACTACGCCGA
CCAGATCTCCGACATGGTCTCGACTATTCTGTTCCGCCTGAAGCCGGCTCGCACGGGCGGTTTGGCCAGCTCGACGCCAC
CCGGTGAGAAGTCCGACGACGGACAAGACTCACCACAGCAATCGCCACAGCAGCACAAGGACAGGACAAAGCAGCACGTG
GTCGAGTCCCTCTTTTCGCTTACCGTAACCAAGACAGCCATGCTGAAGTCTGTCAAGGCCATCCTGCTGGTAGCCAATCC
GCGCACGAACCACGGCGGCAGCCAGACGCTCACGCGGAACCGGGTACCAATCAAAGTATGGGAGGGCACACACTGGCTGT
TGCGTGACCCTGACGGTGGGGTGCGGAAGGCGTATGTCGACACTCTCCTGACATGGCTTGATCGGGAGACGACTGCGGCA
GACCAAGAGGTCCTTGATGATGGTACTGTCGCGCTTGGTACTGGTACAGCCTCCAGCGGCATCCAACCGGCAACGAGGAG
TGGCCGCGAAGCGGCGTCTGGCCCAACAGGATCGGATTTTGGAAAGCGCGCTTTGTCGAGCACATCTCAGCGTGAAAACG
TCGGCAACAGCAACAGCAACGGCGTCATCATCTCCAATGGCGGCTCCAGCAATAGCAACGGTAAGACGAGGTCCCGGCGG
AGTTTCTTCTTGTCGCTGCTGCACCTCGCCATATACGACAACGCGCTAGAATTCGTGGAGTATGAGACCGACCTGGTGCT
GCTGCATGTCCTCCTGAACAAGCTCGCTGATCGACTGGGCGTGAACGCGGTGCGGTATGGCCTGCCAATGATCTTCCAGC
TTCAGGAATCCATCCAGGACGTGGAGACGCCACAGGAGAAAGTACGTCTCGGCAGTGTAGTGCATGGCTACTTCTGGACG
CTCACGGAGAGATTCAACTTTGAGTCGTCTGTCGTGGGCCGGGCTATCCGAAACGAGATCACGCGACGACGCTCCAAGCA
TTTCTGGTTGGAGGGCATACAAGTGCCGCCGACCTTTGTGGAGCTGGCAGGTACACCGGGCATGATGCGGCCGCAGCCGA
GAATGCCGCTGCACGAGATCGAGTCGGAGGCGCTGCTGCCTTTCGACGACCGCCTTTCGCTGGTTGAGTGCGTCAGCACG
GCCTACTACGAGGCTTTTGCAGGCTCGCCACCACAGAGCCCGTCGACGAACCCTGGCCGAGGTGGCAGCAGCGGTGGCCT
CTTTCCCGGATTTAGTCTCGGCAACGCAACCGTTTCTGCCAACACGCAGCGGGAGGTTCCGGCAGCCGTCAGGGAGGAGA
TGCTGTCGGACTGGTCGCGCGACGGCGTGTTGCAGCAGATGCAACAGCACAACAGCAGCAAGTCGGTGTCGCTGAGCGGA
TCGCGCTCGGGAACCATGGCCACTGCCAGCAACACGGTGGCACGAAGCCGTCTGGCCATCAACACACTGAACGGGCTGTC
GAACGGGCAGCTCTACTTCAATGGCAATGGGCCAACATCCCCGACCGCCCAGCAAAACACACGGCCCATCTCGCAGCCGG
CCCGAGCAGTGAACGGCTCGACGGCCAACGATATGCTGGCTGCACCGGTTGTGTCGAAACTTCGCAAGACCAGCATTCGC
AGCGGCCTGTCTCCGTCGCCGATAGGGAGCAGCTCGACTCGAAGCGGCGGCGGTTTTGTCACATCTGTGGACCAGCTGAA
GCTGGCGCTCACGGGCGGTTTGACGTCGCCAGGTCTCGGCCGTGAGCGCAGCGGCGACGCGAACGACGACGATGGAAGCA
GCGACAGCATGGCGAGCTATGACTTGTCGGCATCCGAGGTTTCGTTCAATCCTCCACTGGGCGTTGCTGCTGGCCAGGCT
CAACCATCACAGCAGTCGGATCGAGAACCGTCTAGCTCGCCAGCAAGCGTGAAGCGCAGCTTGTCGGCAGCAGCTCGGAA
AAACTCGACGGCCAGCTCGGGTCAGCTGGGGTCACTGCCTTCCGGAACCAACAGCGACGCAGACGCGGAGGCCGTGCCAC
CGGTGCCGCCGTTGCCATCACCTTTGTTGCGGGGGCAGCAGAACCAGCAGGCCAACGGTGGCTATGCCGGCTATCCTCCC
GTCACGTTTGTATCGTCTGACGGCCGTCCGGCGACTGCATCGCCAGGCAGGACGTCCACCTCGGGAGGAGTGTCGCGGCG
CAACGTCAGGAGCCGTGGAGGCGAGAGTGTGTTGTCGAGCCTGATTAACGACGAGCTTCCAGCTTCGGCAGGCGACCTTG
ACTCGCTGCTGAAGGGCATTGATAGCCGAGCAGGGGAGCACAGTTTCGGGAATGTATCCCGGCCGCCATACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62