GenePrediction:GLEAN_4869 Details

Name: GLEAN_4869
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:873038..871329 (- strand)
Length: 1710
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:873038..872654 (- strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_89:872594..871571 (- strand)
Length: 1024
Type: CDS
Source: GLEAN
Position: GCSC_89:871518..871329 (- strand)
Length: 190
>GLEAN_4869 class=GenePrediction position=GCSC_89:873038..871329 (- strand)
ATGCTCCGATCAGTGCGAAGTGCGGCACCAGCCGCCCGAGGCCTGCTACGTAATGGGCCGAGGGCAGCGAATGCATGTGC
CATTGCTGTTCAGGGCAGAAGCACCAGCGGATTTGCCGCGAGAACCACGCAATCCCAATTCCAGACGCAACAGCGCCAGA
GCTTCCACGCGAGCACCAGCAGAATGACGGCAGCCACACGGACGGAGAGTGATGCCTTTGGCGAGATCCAGGTGCCGGCG
GACAAGTACTGGGGCGCACAGACGGAGCGGTCACTGGAAAACTTCCGGATCAACCAGCCGCAGGACCGCATGCCGCCGCC
GATTGTGCGGGCATTTGGCATCCTGAAGGGCGCAGCAGCGGCGGTGAACGTGCAGTATGGCCTGGGTGAGTGGGCGTGGC
AGCGGACCGCGGCGAGACGGGCGCAGACAGAGCTGACCAGACAGACCCCAAGATCGCATCGGCAATCCAGCAGGCGGCAT
CCGAGGTGGCGGACCTCAAGCTGGTCGACCACTTCCCGCTGGTGGTGTGGCAGACAGGCTCGGGCACGCAGTCCAACATG
AACGCCAACGAGGTGATCTCGAACCGGGCGATCGAGATCCTGGGCGGCACGATGGGCAGCAAGAAGCCGGTGCACCCGAA
CGACCACGTCAACCGCAGCGCGTCGTCCAACGACACGTTCCCGACGGTGATGCACATCGCGGCCGTGCTGGAGATCGAGG
GCGAGCTGCTGCCGGCGCTGCGCAGCCTCCGGGCCGCGCTGCAGGCCAAGGTCGAGCACTTTGAAGAGCGCAAGATCATC
AAGATCGGCCGCACGCACCTGCAGGACGCCACGCCGCTCACGCTGGCCCAGGAATTCTCCGGCTACGTGGCCCAGCTGGA
CTACGGTGTGCAGCGCGTCGAGTCGGTCCTGCCGGCGCTGCGGCAGCTCGCCCAAGGCGGCACGGCCGTCGGCACCGGCA
TCAACACGTACAAGGGCTTCGCTGAGGCTATCGCGGCCGAGGTCAGCAAGATGACCGGCACGCACTTTGAGACGGCCCCG
AACAAGTTTGAGGCCCTCGCCACGCACGACGCCCTCGTCCACGCGTCCGGCAGCCTCAACACTCTCGCCACGTCGCTCAA
CAAGATCGCCCAGGACATTCGCTACCTCGGCAGCGGCCCGCGCTGTGGCCTCGGCGAGCTCAACCTGCCCGAAAATGAGC
CCGGCAGCAGCATCATGCCCGGCAAGGTCAACCCCACCCAGTGCGAGGCCCTGACCATGGTCTGCGCCCAGGTCATGGGC
AACCACGTGGCCACTACCATCGGCGGCATGAACGGCCAGTTCGAGCTCAACGTCTACAAGCCGCTCATCATCCGCAACGT
CCTACACAGCGTCCGCCTCCTGGCCGACGGCATGCGCTCGTTTGAAAAGAACCTCGTCGTCGGCCTGCAGGCCAACGAGG
CCAAGATCTCTAGCATCATGAAAGAGTCGTATGTCCCTCCCGGTCTCCCCTCGTCACATGACTGCTTACTAATCGTACAG
GCTCATGCTCGTCACCTGCCTCAACCCCAAGATCGGCTACGACATGGCCAGCAAGGTGGCCAAGAACGCCCACAAGAAGG
GCCTGACGCTGAAGCAGAGCGCCCTGGAGCTCAACGCCCTCAGCGAGGAGGAGTTCGACGCCCTTGTGCGGCCGGAGCTG
ATGGTCGGCCCCGCCGAATACAAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62