GenePrediction:GLEAN_486 Details

Name: GLEAN_486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:132751..134352 (+ strand)
Length: 1602
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:132751..133067 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_97:133237..134226 (+ strand)
Length: 990
Type: CDS
Source: GLEAN
Position: GCSC_97:134331..134352 (+ strand)
Length: 22
>GLEAN_486 class=GenePrediction position=GCSC_97:132751..134352 (+ strand)
ATGAACAAAAACTGGAACGACCGGGCGGACAAGGACCTCTTCTTTACGATTCTGTCGGTGAAAAACATTGGCGTCATCAG
CGGCGCCGAATGGACCACCATTGGCAACCACATGCGCACGCTCGGTTATGGATTCACAAATGAAGGCTGCCGGTACGTCT
TGCCCAGTGCCTCTCCACCCCTGCTGCCGCCCCATTCTGCGTCGCCACGACGAGCACGGCACGTGTCCCAGCGTCTGAGG
CATCTTTGCCGGCAGCTGCGTGTCGTTGCCGTCGTCGGCGTTGCGTCAAGAGCCGTTGCCATAAAGTACCGGCCTATGTT
AGCAGAAGAGGGGGCGTGAAGCCGAAAAAAAACACCACGCAAAACACGAGGCCGCGGGGGGGGGGAGACAACATCCACCC
GCCCACTCGCGTAGCATTATTTGGGCCTACACAGCTAACTGCATTTCTCTCTCTCTCCCGTCTTCCCATTTCCCCCCCAT
TTGCAGTCAACATTTTCAGGGCCTGCGACGAGCCCAAAACAAGGCCGACCTGAACGGCTCTCCCGGCAGCAGCCACAAGT
CCGATCCCAACCTCAATCCGATTACCCGCAGGCCGGGTCCCGGCCGTGGCCGGCCGAGGAAGCAGGCGACCGGAGCAGCA
GTTGATGTAAGTAGCGGGACGGTCGACGATGACGACGCCGCCGGTGTTGCTGGGGCCATTGCCATTTCTGGCACCGCATC
CATCGGTGCTGATGGGGCAGCCGTGCATCCGTCTGGAGGCAGCCACATGAATGCGGTCGGCCTGGGTGTTGGCGTCATCC
GAAGCATGGATGATCTTGACTCGGCAAATGTAGCGGCAGCAGCAGCAGCTGCTGCTGTCGCAGCTGCTGGAAGGCCCTTA
TCGGACGCCTCCTCGCACCTGATGCTCGCACCACGGCCGATCGAGACGATAGCCACGGGCTCATCGCTGCAATCCATGAG
CGTGCTGTCGGCCAGACTGTCGCAGCCAGGAGGACAGCACGCCCTGCCGCAACCGGGGCTGTCAGGGGCACCAGAGCCGC
TGCAGTCGCTGCAGTCGCTGCAGTCGCTACAGTCGCTGCAGGCGATACAGCCACTGCAACCACAGCAGCAGATCGATCAG
CAGATCGAACAGCAGCTCCTGCATCACCACCACTTGCAGCCGCACCGACAGCTCGATGACGAGACATCCCCGCTGGGTGC
GCTTGAAGATGCGACGGGCGATGACGATGTGGTTGGCGTGGATGATGTCGAGCTGGACGTGGACGTGAATGTGGACGAGG
GCGAGGACGGCGACGATGACGGAGATGGCGACGACGACGACGACGACGACGGCGTGGACGACGACGGGCCCAGCGCGAAG
CGCCGCAAGCTGCAGGCCGTGACGAGCGTGGCCGGCTCGACGCTCGAGGAAGACGCCATGCTGACGGCGCTGGCCGAGCA
CAACGGCACCGCTTCGGTGGACAGCTTTCCGACTGAGTGAGTATTCTTTCGCAATGCTTCCCTGTGGTGAAGTCACGTGC
TTCGCTCCTTCTTCCTTCCCTTTCTTTCTCGGGTTGCATTTGCTGACAAACAATCTGCAGCTTCAGCTATGGGGAGGCAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62