GenePrediction:GLEAN_4872 Details

Name: GLEAN_4872
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:860657..859120 (- strand)
Length: 1538
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:860657..860286 (- strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_89:860220..859120 (- strand)
Length: 1101
>GLEAN_4872 class=GenePrediction position=GCSC_89:860657..859120 (- strand)
ATGTCGGAGGACGAGTCGCCGAGGAGCGACCCGCACTCCAGTGTTCCTGCCGCCCTTCTACCATGGCAGAAGAAACCCCG
TTTTAGTTGGACGCCGGCATACGAGACCACCTTCTTCCAGTCCCTCTGCCAGTCCGTTCAGCTCGGCCTGCGCGAGAATC
AGAGCTTCAAGCAGGAGGCCTGGAACCGTGCTTTGGTGGCCTTGCGCGAACAAGGAGCCTATCCCACCAAGCCCCATCTC
ATCAACAAGACCGATAATGCGCGCAAGAAGTTCCGCCTCTGGCGCGGCCTCGTCGAGAACCCCCAGTTCACGTACAACCC
CGTGACCAAGACCATTACCGGCAGCGAGGAAGCCTGGCAAGCCCATCTCGAGGTGAGTAGGCGCATTCACCGCCCCTTGT
GGCGACGGCGAGCTGACTCGGCTGTCCCGGATGACAGAAAGAGCCTCTGGCGCGCGCATTTCGAGAGCGGCCCTTTGACA
ACGCAGAATACCTCGAGGTCCTGTTTCCCGACGTTGTCGGGTCCCGTGGGCATCCGAAGCGTGTCACCCGTCCGCGGAGG
AAGGGTCCTGACAGCCTGCCCGACAATGAGGCAGCACCCGGCACCGGCATCATGCGACTGCAGAATGGTCCCGGCAACGT
GCACATGAACCAGAACATCCTTACGCCGACTGTGGGCTCGACTCCCATCCCCGTCCCGTCCAACGTCCAGGTCCGCCAAC
AGGTTGCCGCGTCTACCGGAGCCGCTGTGCAGATGCGGTCTGCGCAAGGCTCTGTCAGTGGCGGCGTGTCTGGCCCTACT
TCTACGACTATTCAACCGCCACCACCGCCGGGAACGACGCGTCAGCTTCCCGGAGGTGGCAGCGGTATCGGCGGTGTTGG
TGGTATTGGCGGCGGCGGCACGAACCGCGTCGGCAATGCTGTGTCAGCCTCGGCTCTAACGCCACCGGAGGAGGTCGGCA
CAGTGGGCCAACAGAAACGGTTTGCCCCGGGCACGGACGGAGCCCAGACGTTGTCCAAACGGCGACGGACCGAGGGCAGC
ATCAACGCTGCGGGTAACAACAGCGCCGCTCACCGGAATCGGAGCGAGACGTATGCCAGCGCAGTCGGTGGCGGAGCCGG
TGCTGGCGGTACCGGACCACTGTCTGTTGCAGCCGTAGCAGCTGGCGCAGCCGGCGCCGTGGCGAGAGCTGCTGGCGGTC
AGGGGGTGGATGCGGCACTCTCCGGCATGCGCCAGGCGCAGCCCGGGGGCCTGTCTACGGCGGCATCACGCATCGACGGC
ATCGCCGGCCTGCTGTCCGATGTGCTGACCAAGTATGCCTCGGCCACATCGCTGGCATCAACGACTCGGTGGCCCGAGCA
GGCACTGGAGATCTTCTTCCAGGAGTTTGCCGACGAAGACATGGACTTGCAGCTGCGGATAGCCGAGAAGATCTTGACCG
ACACTAGCAAGGCCGTCATGTTCTGCAAGATGCCGTCGACCCTGCGCAAGCATTGGGTCAAGCGTCTACGCGAGGTCAGC
AACCGGCTCGGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62