GenePrediction:GLEAN_4873 Details

Name: GLEAN_4873
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:856621..852969 (- strand)
Length: 3653
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:856621..856591 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_89:856515..856411 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_89:856323..856037 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_89:855974..855377 (- strand)
Length: 598
Type: CDS
Source: GLEAN
Position: GCSC_89:854896..853202 (- strand)
Length: 1695
Type: CDS
Source: GLEAN
Position: GCSC_89:853138..852969 (- strand)
Length: 170
>GLEAN_4873 class=GenePrediction position=GCSC_89:856621..852969 (- strand)
ATGGCCGAAGGGCCAAGCGTGACCCTGTCGTGTACGTCTTCTACTTGGAGGAAGCAGCATATCGACCCCAACCGAGCAAA
TTGACTGACTGCATGTGCCGGATTAGTTGCGAACAACTTCTGGGGCAAAGACGATGCCGGTGTCGGTCCGCTTCTGGAGC
GGATGCATGCGGCCAAGCAGACGTCTGACGAACTGAAGTCGTTTTACAGCAGTATGCGTCGACCTTTTCGCCCCTGCTGT
GATCAGCTGTTTTCGACATAGCACTGTGGCTAACCCCTTTTTCTTCTTTTGCGTCTAGCCCGAGCATCGATTGAGGATGA
TTACGCCCGCAAGCTGCTGTCGCTGTGTCGCAAGCCATTGGGATCGCAGGAGACAGGCGCCCTCAGGTCGTCGCTGGACG
TGATGCGCGGCGAGGTCGAGTCGATGTCTAAGCAACATCAGTCGATCGCAGCACAGATGAAGACGGAGCTGGAAGAGCCG
CTGGCGGCTTTTGCCGGGGCCATGAAGGAGCGGCGAAAAATTGTGCAGAACAGCATTGAGAAGCTGCACAAGGTGAAGAC
CCAGCAGACACAGCATGTGAACAAGGTGTGTGCCCGAAGTTTGGATTGTTTGGCGCGGCCGTTGGCTAATTTGCGCGCAA
TACACAGTCACGCGATAAATACGAGCAAGAATGTCTCAAGATCAAAGGCTATCTGGCCCAGGGCCACATGGTGATGGGCC
AGGAGGAGAGGAAGAACAAGGCGAAGCTGGAGAAGACACAGATCAACGTGGCGACGACAAACACGGAGTACGAGAATGCA
GTCAAGGTGCTGGAGGAGACGACGGCACGGTGGAACCGCGAGTGGAAAGCGGCGGCAGACAAGTTCCAGGACCTGGAGGA
GGAGCGGCTGGACTTCACCAAGAGCAGCCTTTGGTCGTTTGCCAACATTGCGTCGACGGTGTGCGTGAGCGACGACGCCT
CATGCGAGAAGATCCGGCTGTCGCTGGAGAAGATGGAGGTGGAGAAGGACATTGCCCTCTTCATCAGCGAGAGGGGCACG
GGCCAGGAGATTCCCGACCCGCCCAAGTACATCAACTTCTGCCGGGGCGACCTGGACTCGCAGTCGGAGACATCCGAGGA
TGACAACTACTCCGTGGCCCAGTTTCCGCGCAGTATCAACCCGGCCTACCGCACCTCGTCGCCACAACCGTCGACATATG
AGTCACACCACGACCCCAACAACATGGCAGTGGCCCGTGACATGGGTCTGCAGCCAGACCGCGAGCCAGGGGTGCCATCT
GCTGGACGAGAGGCGGCCGTGCCGTCACAGAAGCTGCTGCAGCAGCCGATGCAGCCGAAGCAGCCGAAGCAGCAGCCGCC
CGTACAGGCTGCACTGCCAGCACCGGCCGAGAAGCCACGGGCACTGATGGGACAGGATCCGTACGGTGGAAGTGGGCATG
CGCAGCAGCTCCAGCTCCAGCTCCAGCTCCAGCAGCAGCAGCAGCAGCAGCAAAAGCAACAGCAACAGAAGCAGCTCCAG
CTCCAACAACAGCAGCAGCAACAACAGCAGATGCAACTTCAACAACAGCAGCAGCAGAAGCAGCTTCAGCAGCAACGGCA
GCAGCAACAGCAGCAACAGCAGAAACAGCAGCAACAGCAGCAACAGCAGCAACAGCAGAATGAATTCTCAGCAGTGCCAC
ACGATCCCTACCCGGCGGAAGGCATGACAATGCTATGCCGCACAGGCGCCGGTGGTGGAGGACAGCCGCAGTCGGACCCG
GGTTCACAGGTGAGCTCCCAGATCAGCTCGCAAGTCAGCTCGAACTCGTCGGGACGGCCGTCCAGCCGCGACTCGCACAG
CGACTACTCCATCCCGGCACCATTCTCGAGCCAGGAGGTGCCCAGCGGCTCGGCGTCGCCGGTCAAGAGCCCAGGTGGAG
GCAGCGATCTGGCTGCCATCGGAGGTGACCCGGGCATGATGGTGCAAGCGGACGACACGAAAGCACAGAAGAAGAAGAGC
GGATTCTTCCAGAACCACAGTCCGTTCCGGCGCAAGAGCACCAAGGACATTTCGGCAGGCGCGACGGCAGCGACGCATCG
CAATACGTGGCACTCATCCATGGCTCAAGGTGGCCCTCAGCAACAGCAGTCACAGCCTCCGCCTCAGCAGCAGCAGAGCG
GCGGTGCCGGATCACATCGCGGCTCGGTGTATGGTGGAAGCAGCAGCAGCCGCTTTGGCAGCAGCATGGGTGTGGGTGCG
ATGGAACAGCCGCGAAACCTGTTGACGGACCGCACGGCCAGCCCAGATCCCATTGACGCGAATGCGAGCCTGGCCCTGAA
CGTGGGCCAGAACGTGTTTCCGGTAGCGACACCGGCGCGCCGGGGTGCGGGAGGCAGCAATGGACAGTCGGCTCCGGCCG
AAGCTGCTGAGGAAGATCCGATTGCACTGGCGCTGGCAGAGCTCAAGGGCGTCACGGTTGGCGGCAAGCAGTCGGCGGGA
CGGATGTCGGCCGACCACTACCACGGCATCTCGACGCCGGTGCCGGGAGCCCGCAGCTCGACTCTTGGAGCCAGCAGCGG
CAGCAACGGCGCGGTGGCAGCAGCGATGCGCGGCACGCCGCCTCCGTCGTACGATCAGCAAGTGCAGCGACTGGGCGTTC
CGGCGGCGGCTGTGACGTCCAAGGCGATGAAGCAGACGTCGCAAAAATTTGTGGACCAGACGCGCAATCTGTTCAGCCAG
CCGCCGGGTGGCAACCGCCACGGAGCGTCGGCGTCGATGTCGAGCAATGCATACACAACTCCGCAGTCTCGCAGTGGAGG
TGGTGGTATGGGAGCGGGAAGCGTCAGCGGTCGCAGCAGCGGTCGCAACAGCTACGACATGCCGCGAGACACGTCTCCAC
GGCCAGGCACAGCAGCAGCGCGACAGCAGTATCAGCAGTCACCCCAGCAGCAAGACTACCGGCGGTCGACATCGCCGAAC
CCCCAGGCCGAACGGCAACGACGGCAGTCATCGTACCAAGCGCAGCAGCAGCAGCCGAGAGGCTCTGAACAGAGCTTGTA
CGGCCACCAGTCGTCCAACAGCATGCCGTCACGGGCTGTGTCTCCGTCACCATATCGCGGCGATTTCCAGCCAGGCAGCA
GCGTGGGCAGTGGAGGTGGCGGTTATGGTGGTGGCAGCTATGGCAGTGGTGGTCGTCCTGGCAGCAGCATGGGTGGCAGT
CACAATGGCGACATGGCAGTGCAGCTGGCACCGATCGGCCCGACATCAGCGGATGACGGCTATGGGTCTCAACGCGGTCG
TGGCAGTCGGCCGGGGACCAGCAGCTCCAACTCGCGGGCAATGGGCCTGTATGAGGGTGCAGGGACGTTGCGGCAGCGCA
GCAAGAGCCTGGCCGAGAATCGGCAGTACACGCGGGACGGGCGACCGATTATGCATTTTGGTGAGTCAGCCTACTTCCTC
TCTGACCTGTCCTGCTGTCCATGCACTGACAAAGCCAAAACAGCACGTGCACTCTACATGTACCAGGCTGCGATCCCCGA
GGAGCTCGGCTTCGGCAAGGGCGACGTGTTGGCGGTACTGCGGCACCAAGACGACGGCTGGTGGGAGGCGACGGTGCATG
GCGGCAGCGGACAGGTCGGGCTGGTGCCGAGCAACTACCTGCAGCCGTGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62