GenePrediction:GLEAN_4874 Details

Name: GLEAN_4874
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:852189..850927 (- strand)
Length: 1263
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:852189..852002 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_89:851938..850927 (- strand)
Length: 1012
>GLEAN_4874 class=GenePrediction position=GCSC_89:852189..850927 (- strand)
ATGCTCATGTTGGAGGACGCCTACCGGACGGTGACGTCCAAGGCGGTGCGCCGCACGCTCGTGTACGGGGTGTTGCTGGC
GACGGCCTCGGCCCTGCTGTACGGCGTAGCCGTCGTGGGCTATCTGGGCTTCTACCACGACTACGTGCCGCACCGCGTGC
GGACGTCGCCGCTGCACTTGCAATACGGGTGAGTGGGTGAGCGGGAGGGCAGACCGACCGAGGCGGCCGGCTGACGGGGT
GTGTGCAGCAGGACCGCGGCGCAGCATCCGTTTGCGATTGCCGATCTGCGCGGTCTCAGCCTGAAGACGGACCAGGCCTA
CGACGTGTCGGTGAGCGTGCGGCTGCCGCGATCGCCGGCGAACCAGGCGGTCGGCAACGTGATGCTGGAGCTGGCGCTAG
TCACGGCTGGTTTGCCGTCGTTTTCGGCTTCGTCTTCGTCTTCAACGCCCGACGCCATCACGACGGCCGCCCGTCTGCCA
CCAGACAGCCCGCGCGACTTTCTCGCCGCCGACGGCCGCCGTGTCGTCTATGCGGCCACTCGACCGGCTCTGCTGGCCTA
CGTGGACCCGCTCGTGGCCACGGCCGGCCGCCTCGTCTTCTTGCCCTACCACCTGCTCGCGCCGGCCGCCGCGCCCGAGT
CCGATCGCCTGGTCGTGTCCATGGCCGAGTCGCTCTCGTTTGCCGGCGTGGACGCGCTGCCGGCAGCGCTGTATCTGGAG
CTGCGCGTCCCGCCGACTACCGGCCAGCACCGGCAGCTACAGACGTACGGCGTCGATGTCGTCTTTGCGGCCCGTCTGCG
CGGCCTGCGCTGGCTCATGTACCACCACGCGGTCGCCTCGTTTGTCGTCCTGACGGCGGCCTTTTGGCTCGTCGAGGTGC
TCTTCATGGCCGCCGCCTGCGCCCTTCTGGGCACGTTCCTGGCTGGGAGCGCGGATGTGGATGCGGATGCGGATACGAAG
GCAGAGGGTGGCGATGATGGCAGCGATCAGGGACGCATGCTTCCAACGGTCGTCAAGACACGGGCGGACGAGGATGTATC
AATCAAGAAGGAGGAGGACCAGGGCGGCCGTCGTTTGGGTCGGTCGCTGCTGGCTTCGATCCCTGCACGGGCCGTCGGCC
ATGCAGACCACCAAGCGGACGACCATGTGGACGATCCGGTGAACGAGGAGGCAGACAGGCCTGCTGCGATCACTACGGGC
AGCTCGGCCGTGGCGATGGAAAGCTCGCTTCGACAGCGACAGCAGCAACAAATTGCGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62