GenePrediction:GLEAN_4875 Details

Name: GLEAN_4875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:847556..845710 (- strand)
Length: 1847
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:847556..847302 (- strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_89:847240..846826 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_89:846765..846439 (- strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_89:846382..846183 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_89:846118..846013 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_89:845963..845710 (- strand)
Length: 254
>GLEAN_4875 class=GenePrediction position=GCSC_89:847556..845710 (- strand)
ATGACAGAGCTACAGACGAAGACGAACAGCGCCGTCGATAAGGCCACGGTGGACCAGGTTGAGATGTGCGATGACGGCTC
GCTGGCCGAGAACGAGGCGAAGCAAAAACTCGGCCACGGAGGCGACATTGCGCTGGCTGTGTTGGGCGAGACCGATGAGA
TGGGCGAGATTGACCCGGCCGAGGAACATCGGCTGGTGCGAAAGATCGACCGGGTGCTGCTTCCGCTGTTTGCCATGTCG
TTTATGTTTTTTTATGTAAGTGTCTAGTCCCGAGATAGAAGCCGAATGGGCGTGAGTCTGATGCATCTGTCCACAGGTCG
ACAAAACCACGCTCTCGTACGCGGCCGTGTTTGGCATCCAGAAGGACCTGCGCCTGCACGGCACCGACTACAGCTGGCTG
TCGGCGCTCTTCTATCTCGGCTTTCTCGCCTGGGCTGTGCCGGCCAGCATGTTGCTGCAGCGTCTGCCCGTCGGCCGCTA
TCTCAGCACCATCTTTCTCTGGGGCGTCCTGTTGATGGCCCAGGCCGCCTGCCACGACTTTGCCGGCCTGGCCGTCTTGC
GCGTCGTCGGCGGTGCGGCCGAGGCTGTCGCCGATCCCGCCTTTATCCTCGTCACCAGCATGTGGTACACCCGCCGCGAG
CAGCCCGTCAAGATCGGCCTCTGGTACTGTGCCAACGGCCTCGGTGTTGCCGGTGGCGGTCTTCTCGGCTATGCCATCGG
ACAGATCCGCGGTGCTCTGGCTCCCTGGCGCTACGAGTTCCTCCTCATCGGTGCCTGCTGCTCGCTCTGAGGCCTCTTTG
TCGCTATCGCCCTGCCGGACAGCCCGGTCGATGGGGGCCCGAGGACCAAAAACCGCTTCGGCTTCGGCTTCTCTTCCTTC
AGCATCAGCCGCATCCTTCTTCCCCTGACCGCCCGCAAGCGCCGGCTGGCCGTCTACCGTCTCCGCGACAACCAGACCGG
CATCGCCAGTCCCACCTTCAAGAGGCACCACGTCGTCGAGGCCCTCTTCGACGTCAAGACCGTCCTCTTCTTCCTCATCG
CCCTCTTTCACTCGACCACCAACGGCGGAACTACCAACTTTGGCACCATCATCACCAAAGGCTTCGGCTTCTCTACACGT
AAGAGCACAGCCCGGCAGCAGCTAGATCTCTTGTTCTGACCATCCCCCTCCCAGTGGTCACCACCCTGCTGCAGAATCCC
TACGGTGCCTGCATCTTTCTCTTCATCCTCAGCAGCGTCTTCATCAACGACCGCCTGCCGCCCAACAGCCGCTGCCTCGT
CATGGTGGCCTTTCTTCTTCCCAGCATCGCCGGCGCCTTTGGCCTACACTACGTGCCCAGCGACCAGCGCGTCGGCTGTC
TGATCTGCTACTATGTACGTGTGTCCCAAGACGGGCCTGTCCACGCGTTGCTTAGTCATCAACTGCTCACAAGCCCAGCT
CACCGGCTCCGTCACCGCAACCTGGGTCCTGCTGCTGTCCATGCAGACGGCCAACGTGGCCGGCCACTCAAAGAAGATGA
TCACGTCGGCGCGTCTGTTTCTTGGTAGGCCTGTCTTCCCCTCCGCCTCCATCGCACCTTCTGACACGACTAGGATACTG
CACCGGCAACATCGCTGGCCCCTTCTTCTACAAGGCCGAGCAGGCCCCCGTCTACTCTCTGGGCATCTGGAGCATGGTGG
CTGTCCTTCTGCTCGAGACGGTCATGATCCTGATCCTGCGCTTCGCTCTGGCAGCCGAGAACAGGCGGCGCGACCGGCTG
CAGGGCCCAGAGAGAAGGAACTTGGACGCCACCGCTTTCGAGGACTTGACGGACAAGGAAAACATGAACTTTCGCTATGT
TTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62