GenePrediction:GLEAN_4876 Details

Name: GLEAN_4876
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:845167..843268 (- strand)
Length: 1900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:845167..844968 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_89:844911..844899 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_89:844829..844754 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_89:844689..844077 (- strand)
Length: 613
Type: CDS
Source: GLEAN
Position: GCSC_89:843995..843789 (- strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_89:843732..843665 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_89:843614..843519 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_89:843458..843268 (- strand)
Length: 191
>GLEAN_4876 class=GenePrediction position=GCSC_89:845167..843268 (- strand)
ATGGCAGCAAACATGCAGAACAGTTTTGCCCTAGACAGCAAAAACGACAAGAAGGACGACCTCGCCATCGACATACAGAC
GCTTGAGGCCGTTGCCACCAAGAGCCCAGAGAGCGAGTGTCCACAGTGGATCCGCGATGCCTCACCTGAGGAGCTGGCGG
CCAAGGAGACGCGTCTGCGGCGCAAAATTGACATCCGGCTGTAGGTTATGCTGCTGCTGCTGCTGCTGCTGCTTTTGATC
TGTGCTGACCCGACAGGATGCCCTTGATCGTCTTGATGTATATTCTGAACTAACTCGACCGCAACAACATTGCCGCGGCC
GGACTGTCGCATCTGCAGCGCGACCTGCACCTCAAGGGCTACCAGTTCAACACCGTCGTCAGCATTCTCTTTACCGGCTA
CCTGCTGATGCAAGGTGAGCTTCGGCGTTGTGGTGTCGTGTGTGATGCTTACTAATCAAACATCCCCCCCCTTAACAGTG
CCCTCCAACATGCTGCTCAACAAGCTCGGCCGGCCGGCGCTGTACCTGCCCGGCTGCATGCTCATCTGGGGCGTGGTCTC
GGGTGCGACGGCAGCGTCGCAGTCGTATGGCGGGATGCTGGCGGCCCGCTTCGTGCTCGGCTTCATCGAGGCCGCCTACT
TCCCCGGCTGCCTCTACTACCTCTCATGCTGGTACACGCGTCGCGAGCTGGCCCTGCGCACCGGCATCCTGTACAGCGGC
TCGCTGCTGTCGGGCGCCTTTGGCGGGCTCATCGCCGCCGGCATCCTCGACGGCATGGACGGCCTGCATGGCCTCAGCGC
CTGGCGCTGGTTATTTATTCTGGAGGCCTGCCTCACCGTCGGCGTGGCACTGGGTGCTTTCTTCCTGCTGCCGAACCTGC
CACGCACCACACGCTGGCTGTCGGCCGAAGAGCGCGAGCTGGCCAGCTGGCGGCTGCAGGCCGACATTGGCGAGGACGAT
TGGATCGATAGCCGCCACCAGTCGCCGCTGCACGGCTTCCGCCTGGCCGCCACTGACGCCAAGACGTGGCTCATCCTGGT
CGTCATCTATGGCTCGACCGCGAGCGGCTCCATGACGACCTTCTTTCCAACGTGAGTGGAAGAGAGAGGGGGGGAGAGGG
AGAAAAAGAGAAAAGAAAAAAAAAAGAAAAGAAAGAAAGACTAACAAACTAGTGTTGTCAAAACCCTTGGCAAGGGAAAC
ATCACCACCCTACTCCTCACCACCCCTCCCTACCTGATCGCCGTCGCCGCCTGCTTGACCAACGCCTGGCATGCCGACCG
CACCGGCGAGCGGTACCTGCACATTACCCTGTCTCCCCTGTTAGCTATGGTTATGTATATCGTCGCCATCTCCACCACCA
AATTTGCGCCTCGCTACTTGTAAGTGTACCCGTTCCTCCATCCTCTTGCTTCTTTAACAGTGACTGACAGCACAGCGCTA
TGTGCATCATGGTAGGATCGACGTACTCGGGCTACGTTGTCGCCCTTGGCTACATCTCTAACAGTAGGTTTTCCCCATCT
TTGTTCCCCTGCCTACACCTGCTGACCTACTAGTTCTTCCCCGGCCTGCCAGCAAGCGTGCCGCCTGTCTTGCACTTATG
AACAGTCTTAGCAACGTCTGCCAGATCTACTCGCCATACCTCTATCCAAGTAAGTAAAGTGTGAAACTTAGAAAGCTTCC
AGAAAACTCAGGCTCACATTCATCCCCAGAATCTGCTGCCCCTCGCTATGCCACTGCCTTTGGGGTGAACATTGCCATGT
CCGCAATGACTGTCATTGCCGCCACCGGCTTGCGCTTCTACCTTGCTCGTCTGAACAAGAAACTCGATCGCGGCGAGCAC
GTACGTGATGTCAGCTCCAGTGGGGCTGCTGGAAATGATGGATTTCGCTTTCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62