GenePrediction:GLEAN_4877 Details

Name: GLEAN_4877
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:842351..840686 (- strand)
Length: 1666
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:842351..842291 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_89:842232..842015 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_89:841961..841768 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_89:841709..841226 (- strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_89:841132..840686 (- strand)
Length: 447
>GLEAN_4877 class=GenePrediction position=GCSC_89:842351..840686 (- strand)
ATGGCCGAGAAAAAGGCGGACGCCCCGGCAGCTGGCATGCTCTGGGGGGGCAGGTTCACAGGTTCGATTGTCTCGGGAAA
CAAGCTTCAGATGTAGTATACTGACCTCACGGTACGCAGGTGCGATTGATCCTCTCATGTATAAGTACAATGCCTCCATC
CAGTACGACAAGGCTCTTTACAAGGAAGATATCCTTGGATCGATTGCCTTTGCCAGAGCCAACTCAAAGGTTGGCATCGT
CAGCGAAGACGAATTTCAGGCGATTGAGCGTGGTTTGCTCCAAGTGATGGAAGAATGGAAGCAGGGAACTTTCGCTATCA
TGCCGAACGACGAAGATGTGAGACACCGCCCCGTTCTACTCAACTTCTCGAGGCTAACACAATGGACCAGATTCATACGG
CAAACGAACGTCGCTTAGGAGAGGTTATCGGCAAGGACATCGCGGGTAAGCTGCACACAGGTCGCAGCCGCAACGAGCAA
GTTGTCTGTGATATGCGCATGTGGTTACGGGATCGGATCCGCGAAATCGACAGCCAACTCGTTGCATTCCTCAGAGTCAT
TGTCACACGTGCCGAGTCTGAAATGTAAGCCTAGCCCCCCACATCTGGCCAAAAGCAGCCTCCTGCTGACTGACAACCCC
AGCGACTACATCATGCCTGGATACACCCATCTCCAGCGTGCCCAGCCAGTTCGGTTTTCTCAATGGCTGATGTCATATGC
CGCTGCGTTTAAGCAGGATCTTGAGCGGTTGCGCCAAGTTTTCGAAAGGGTTAATTTAAGTCCACTTGGTTGTGGCGCTT
TAGCTGGCAATCCATTCGGGATTGATCGAAATATGATAGCTGAGGAGCTTGGGTTTAGCGGAATAACCTTGAACTCCATG
AATACTTCGGCCGAGCGCGATTTCCTACTCGACTTTCTTGTCTGGAACTCGATTTTCACCAACCACGTTAGCAGGTGGGC
TGAGGACCTCATCATATATTCGACATCTGAGTTCAGCTTCGTGCGGCTGGCCGACGCCTATTCTACGGGTAGCTCTTTGA
TGCCCAACAAAAAAAACGGGGACTCGTTAGAGCTTTTGCGCGGCAAGTCAGGCCGTGCTTTCGGTCAAATGGCTGGGTTG
ATGATGGTGAGTCCTCATATCAACATCTCAGATAGTTGCCTTGGCTTTGGGGGTGACCAGGAGTGTATCGAGAGTAGCTA
CTAACTGTTCACTTGAAAGACTCTGAAAAGCTTGCCATCTTGCTATAATAAAGATCTCCAGGAAGGGTGGGAGCCTATGC
TGGATTCGGTTCAGACTGTGTCGGACAGTCTAGGTATAGCCAATGGGGTCCTGTCTACATTAAAGGTGCGGCCGGAGCGG
ATGGAGGCTGCTCTGGACAAAACGATGCTAGCTACTGATGTCGCAGAGTGGTTGGTGAGGAGGAAATGTCCGTTCAGAGA
GGCTCACCACATCTCTGGACGCGTCGTTGCACTGTCTGAAAAGCTGGAAATTTCGATGGACAAGCTGACCCTTGAGCAAC
TGCAAGCCATTGATTCTCGGTTCACAGCAGACATTGCGGAGGCATTCGAGTATGAAACGAGTGTTGAGGCAAAATCGTCT
AAAGGCGGTACTAGCCGATCAAGCGTGCTGGAGCAGATCCAGGTACTCAGGGCTATGTTAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62