GenePrediction:GLEAN_4878 Details

Name: GLEAN_4878
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:836470..829981 (- strand)
Length: 6490
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:836470..836205 (- strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_89:836122..834797 (- strand)
Length: 1326
Type: CDS
Source: GLEAN
Position: GCSC_89:834729..834318 (- strand)
Length: 412
Type: CDS
Source: GLEAN
Position: GCSC_89:834264..833748 (- strand)
Length: 517
Type: CDS
Source: GLEAN
Position: GCSC_89:833288..830503 (- strand)
Length: 2786
Type: CDS
Source: GLEAN
Position: GCSC_89:830448..829981 (- strand)
Length: 468
>GLEAN_4878 class=GenePrediction position=GCSC_89:836470..829981 (- strand)
ATGCCGGCCAAGATGGAGCACCAGCCAGAGCCTGCTGCCGCGTTTCCGCCGCCGCGTTCTCCCGACCCTTCTCCACACCA
GCTGTTCCGCCAGCCTCAGCCGTCCGAGACACACCAACAGCAGCAGCAAAACCAGCAGCCACAACGACAGCTCCCAGATC
TGGCTTCCCCTTCCGAAACGCCAGTCGAAGGGTCTTCCAGGAAGCGGAAGCGGGTGCCACCAGAGCTACGACGACGCGTT
ACACGTGCTTGCGACCGGTGCAAGAGGTAAGCGAGCAAGGCTCGGCTGTGTCTCTCGTCTTTCCACTATCTTCAAGTAGG
ATGAAGGCTGTTAACAAGACCCGGATAGACGAAAGGTCCGCTGCACGGGCGACAAGCCATGCCTGCACTGCACCGAGGCA
AAATCCACGTGCACATACGACCTGACCTATGGACGCGGTCGTCTGCCGCCGATCCCATTGGCCCAGGAATTCTCTCCAAC
GGGGCCGTCCCTCAATGAAGTCTCCGCTCCACTGCATACACGCAGCTTCTCATTTTCCGCAGGCAGCAGGCCTATAGCGG
CTGCGCCGGTTGGCCTAGGCGAGCGGCTGTCCTTTCTGTCTGAGGCTGCCACAACAGCCAGGATGGACCGGCAGCAGCAG
AAACAGCCGTCGAACTCGAGCATTTCCAATCCGCCCAGCTCTGGAAGCATCAATACCAAATTCAGCAGCAACCACAATGC
CGACAATGACACCACCACCAACAAAATCAACGCCGTCATCTCAACTTCTGCCTCAGCTACAGCTCCGGCCTATGCCATCG
TAGCCACGTCTTCCCGCGTCTCTCCCGAGCCTTCGCAAACAGATCTGCAGGGACATTACGTCGGTCCGTCTTCTGGCGTC
TCCTTCTTGCTTCGTGTGCAGAAACGCCTGCACGAGACTGTGTCCTTCTCCCAGGCCGCATCTTCCTCCATCTTCACCTT
TGGCGACGCACCACTGCCGGAGTATGACGCTTCCTTTCCTCTGCTGTTGACCCGATCCGAGGCAAACTCTCTTCTGGAAC
GCTATTTTGACTTTGCCGTCCCTACTCACCGTTTCTTGCACCGGCCCACTGTCGAGGCCTGGCTAGCCGAGTTCTACGCC
ACCAAGGGCAGCATGGCCAGCCACGAAGACACCCGCGCCCGCATCGCCGTGCTTTTCATGGTTTTTGCCATGGCCACCGA
GTACATGTCACCAGACTCAGCCGCTCCAGGAATGGTCTCCAGTGCCCAGTACTTTCTCGCTGCAGAGCAGCAGCTGTCCA
AGGAGCGTGGCTCTGTGCGCCTGGCCAGCGTTCAGGCTCGGCTCTGCCAGTGTTTCTACCTCCTGGCCCAGTCACGCATC
AACCACTGCTGGAGCCTGTTCGGCACCACTGCCCATCTGGCCCTGGCCATTGGTCTCAATCGCAACCGGCGTGCCGACCC
TGCCTCTGGCCTTGGGCACATTGATGTCGAGTGTCGTCGCCGCACGTTTTGGTGCACATATAACCTGGATAATTACTTGA
GTGCCGCTCTCGGCCGCCCGAAAACGTTTCATGATGAGGACATCGATCAGGAGCTGCCCTCGATCCTGGAAGACAGCGAG
ATCTTCCACGACGAGATCAGGCCCGGCCAGCCCCGTGGCCAGTCCACGATGCTGGCACCCGTGGCACATGTGCGGTGAGC
AGCCTCTGCTGTCCTGATGTTCCTGCATAAATATTCTGCTGACCCTCTATCTTCTTCCCAGGCTTGCGCGGATAGTGAGC
GTCATTCTTCGCGATCTCTACTCCATCCATCCCATATCCACATCTACACGCGCGTCGTTGTCGCGCAAGCACTCGGAGGC
TCTGGCAGCATGGCGCAGAGAAATATCTCGCTTTCTCGATACCGACCGCGATGGCGCCTCCCTGCTGATGCCCGTCTTCC
AGCGACAGATCAACGTGCTAAACTTGGCCTACTGGCATGCCCTGCTGCTCACGCACCGGCCGCTACTGCTCAGCAACTTT
GCCTACCTCCAGCGTTACGGCGCCGACTCGCGTAACGCGTCAGACCGCGTCTACATCCAGGAGAGTACAAACCGGTGTCT
GGACGCCGCCATGAGCATCATTGAGATTGTGGACAATATATCTCAGGGCGGTCAGCTCTTCAAAGCTTTCTGGGTATGCT
TTGTCCCATTCTCGTCTCACGTTGTCAAATCCAGCTGACAAAGCAGTTCACTATGTATTTTGCCTTTTCTGCCGTCGTTG
TTGTTTACGTCTATGTCATTCAGCACCGGTCTTCTCCACCAGAGACATACGGACAGTATCTTTCAGCGGCGATAGAGTGC
CAACGCCAAATTGTTCAGCACGCCGAGACCGGATCGCTGGCGCAACGTTACACGCTCGTCCTCGAGGAGCTGCGCCTTGT
GACGGTCAAGCAGGTCGGACTGCAGCGACAGACCTCTATGCTGCCCACTCGGACTCCCCATGCCGGCGGGAATGAAAACG
GTCGTAGCAGCAGCAGCAGCAGCATTCCGTATGCTGCCGGCGTCGAGGCCAGCTTTCGTTCCATGGGCATTGCAGGCATT
GTCAATGATCCATTTGATCTGTCTGGCGCACCCTTGGACGAAGGAATGGTGGACTGGAACGAGAGCCCCAGCAGCTCTCT
GGCCGATTTTACCAGCTGGGGCCACTTTGACTCCATGGTCTCGTCCGGCTTCTGGCCTTTTGATTCCATAGCCAATGAAG
ACCGTACATTACGCATGTGACAGCTTTCAGAAAACTGGGGAACGCAAACGATCAATTGCCGAACCATACACAACCTTGTG
CTTGCACGGAGTATAGATCGTCACCCCGCAACTTGGCTTATTAGTGTCATTAGCACAAATTACAACGGGTCGTTGGCGCT
GCGCTTTATCCGATGTGCTTTTCCGATGCACTAACAAGATCTCCACTGGGACCTATCCGAGAGAGATTCTGCTCGGCACA
GGTTTACGCCACGCGGAGAAGACCAGATGCAGAAATGCGGCCGAAGAAGGTGCTCGGCTGACTCTCACTATGGCTACTAT
TCCAGCTCTCAGGTCTGCTACAGCATCCTATAAATTCCCGCTCTCAGAGATGCCTATAGCACACAGCAACAAACCTACCA
GACACAGACAAAGATCGCCAGGTCAAGCACAAGTCCTGGACTCGCTGACCTCATCATGGCAGCTACTGCGCAGGCTCTCG
CCCCCCTTCAGCACTTTGCTTCTGGCATAGAAGCCAAGAATACCGTCGAAATATACACCATGTCGGTGGCAGACGACAGC
AGCCCGCCAAAAATGGTCAACGACCTCCTGCTCAGCCGTGTTCGTAATTCCCCGGAAACACAGTTTCTGGGATACCCTGC
CACATCCAAAGGCAGGGCCGACTACGTCTACCACACAGTTCAGGACGTTGACCGTTATGCCACCACTGCTGCATGGCGAT
ATCTGCAGTCGGGACTAATTCCTGAACATCCTAGTCCCAGCAAGGCCGAGGTGGTGGCCATCTTGGCGCCATCCAACTTT
GACTATGTCGTGTCCATCTTCGCGTTGTCGCGGCTGGGCTTCGCCATCTTGTTCCTGTCGAATCGCCTAGCGCCTGATGC
GATTGCCAGCTTGCTTCGGAAGACGGCATGCACCAAGCTGATCGTGTCGGCGAATCACGCACCCATGGCTGACCGGCTGC
GAGACGAACAAAAGTGCCCTGTCTCGGTCTTTCCGATCGTTGGGCACCCCGACTACACCTCGCATGCCTCGCAGAAGAGC
TTGCCGGAAATTGCTATTTCCAACCCATCACGGCGAATAGCCTTCATCATCCACTCGTCTGGCTCTACCGGTTTGCCGAA
GCCCATCTCTCAGACACACGGTGCCTGTCTGGCCAACTATGCTGGTGGCATCCCCTTTCGCGCCTTCATCACGTTGCCGT
TGTACCACAACCACGGAATTTCGACGCTCTTCCGCGCCCTCTGTGCTGGAAAGAAGGCTGCTCTCTACAACGCCAGCCTT
CCTCTGGCTGGCAGCACGCTGGTGGAGTCCATACGAGCTGTGGACCCCGAGAGCCTGCACTGCGTACCATACGCACTCAA
GCTGATGGCTGAGGACGCGCGCGGCATCGACACACTCAAGCGGCTGAAGCTAGTTCTTTACGGCGGTAGTAGCTGCCCTG
ACGAGCTGGGCAACCGTCTGGAAGATGCCGGCATCTACCTGGCCGGTCACTACGGGGCAACGGAGATGGGCCAGCTGATG
ACCTCCTTCCGGGACCCGGTTGTCGACAAGGAGTGGGCCTACATGCGTCCAGTGCTGTCGGCAAAGCCTTTCTTGCGCAT
GGTCCCACGTGGCGACAATACGTTTGAATGTGTCGTTCTTGACGGTCTGCCATCCAAGGTGCTGTCCAACTCGGAAGACC
CGCCAAACTCGTTCTACACCCGCGATCTCTTTCAGCCGCACCCGACGCTGCCTGATGCCTGGAAGTACCTTGGCCGCATC
GACGACCGGGTGACGCTGATCAATGGTGAGAAGGTGCTGCCCATTCCGTTTGAACACCAGATTCGTCAGCACGACCTCGT
GCGCGAGTGCGTCGTCTTTGGCATTGACCGGGCGGTGCCGGGCCTGGCCATCATTCCCAGTGACAAGGCCAAAGGTCTGT
CCAAGAGCGCGCTGCTCGACGCCCTGATGCCGGTTGTGGATGCCACCAACGCGCACACAGAGGCCTTTGGGCGCATCTCG
CGGGAGATGATCGAGATCCTCGACGGCGACACGGTATATCCGGCAACCGATAAAGGAACAGTAATTCGTGCGGCCTTCTA
CAGCCGGTTTGTCTCAGTCATTGATGCCGTGTATGCACGCTTCGAGGCAGCGCCAGCGGCAGAGGAAGGGGGGGACGGCC
TGCGCGTGCTCGATGAGACGGAGCTTGAGACATATCTCCTCGACATTTTCGTCAACAAGCTGGGCATTGTGGGCTTGCAG
GCCGAGACGGATCTGTTTGAGGCCGGCGTGGACAGCCTGCAGGCAATCATAGCGCGGGCTCAGATCGTGCGCGAGATCGA
CCTCAGCAGCAAGCGGCCAGCCCAGAACGTGGTGTTTGAATACCCGACGGTGCGGCTGTTGGCTCAGCACCTGGTGTCTC
TACGCACTGGGGCTGCCGACGGCACGGAAGGAGACGTCGCCGCGGGGGAGATTCAGGCCATGCGAGATCTCATTGCCAAG
TACAGCGACTTCTCTTCCTTTACGTCCCTGCCGGCAAGCACTCACGTGTGTCCGGAAGGCAGGGAGGGGGCCGAGACCGT
TCTGCTTACGGGGGCAACGGGCTCACTGGGCGTACACATTCTGCGGAAGCTGGTGGACAAGCCGCACGTGACGAAGATCT
TCTGCCTCGTGCGGGCATCGTCGCAGCCGGCAGCCAAGGAACGGGTATACGCCACGCTGGCAGCCAAGGGCCTGCCAGCC
TTGACGCAAGATGCCCAAGATAAGGTAGTATGCCTGCCGGCAGACCTGAGCCAGAAGACACTGGGACTGGACGACGACAT
ACTGGCACAGCTTCGGCGTCGGTTGACGACAGTGGTGCATGCAGCCTGGGCCGTCAACTTCAATCTGGGCGTACGCAGCT
TCGAGGGGCACCACATTCGCGGCACATACAACCTGCTCAACACATGTCTCCGAGTCGAGGGTGCCCCCGCACGGCTGTTT
TTCTGCTCGTCTATCTCGGCGGGTGCGGGCACGCCGATTCCAGGCACCGTGGCAGAAACGTACATTGAGAACCTGGCACA
CGCACAGCCGATGGGTTACGCACGGTCCAAGGTAGTGACGGAACACATCATCAAGGCGGCAGCAGCGCAGACAGGCATGG
CCGCACGGGTACTGCGGCTCGGCCAGATCGTGGGCGACGCAGACGAGGGCATCTGGAACACGACCGAGGCCATTCCATTA
ATGCTGCGAAGTGCCCTGACAATAGGAGCCTTGCCGGCTCTGAGCGAGGTAGGCGACCGTTCTGTGCTCTCATTGCTTCA
TAGCTGACTCATCCTCCCGCAGACACCTTCATGGATGCCAGTGGACAAGATGGCCCGCGCTGTGATGGAGCTGTCTGGCC
TGTCCGGGTCTCGCGGCCCAGAGCCGGACAAATCTCTCGTCTACCAGGTGCAGAACCGGCGGCTCTTCGACTGGACCGAG
GAGCTGCTGCCAGCTCTGCGGGCGGCCGGTCTGCCGTTCAAAACGGTGCCGCAGCGAGAATGGGTGGAACTGCTGCGGGC
TTCGGACGCCGACCCGACGCGCAATCCGACGATCAAGCTGATCGACTTCTTCTCGGAAAAGTACGACAACGACCGGCCGG
GACGCTCCGGGCTGGTCTTTGAGACCGACCGCACGGAGCGGGCCAGCAAGACGATGGAGGACGGCTTCGACATCATCGGC
AGTGGGCTGCTGGACAAGATGGTCGCCTGGTGGAAGACGCAGTGGACGGCCGGAGCGGCAGACAACGGCGATGCACATGG
ATGCAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62