GenePrediction:GLEAN_4879 Details

Name: GLEAN_4879
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:828264..826219 (- strand)
Length: 2046
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:828264..827211 (- strand)
Length: 1054
Type: CDS
Source: GLEAN
Position: GCSC_89:827135..826741 (- strand)
Length: 395
Type: CDS
Source: GLEAN
Position: GCSC_89:826686..826219 (- strand)
Length: 468
>GLEAN_4879 class=GenePrediction position=GCSC_89:828264..826219 (- strand)
ATGCCTTGCTTCAGAGGCATCGCCGTTAGCATCCATGCTAACGGCGCTCCGCTCCCCGAACACGGCATCCAGAAGCAGTC
CCGGGTCTCGCGTATCAACAGCTACATTCCCGTGCCGCAGCCGCAGCTCTCGCCCGACTCGAACAAGCCGGAGGCGGCCA
AGTTTGCCATCTCCATCACCCTCCTCACGCCGAGCCTGCCCATACCATACTCGACGCCCAAGCCGACCGAGGCGAATCCG
TACCCGCGGCCGCAGCTAGTCGGTGAGCTGCCGCCGGCCCAGGAAGAGGGCCGCGTCAATGGCATTGTCGCACCCTACAT
TCCGATGACGAACTCGGAGAACGAGACGATCGCGGCCTACATCTATTTTGACGGCCGCGCCAAGGAGGAGGTGGCCACGC
TACTACGCCCGGGCGAGGAGACGTGGGTGAACAGCCGGTGGGTGCAGGTGCCCGAGTCCGAGGGCGGCGGCCTGGCCGAG
CGCGAGTTTCTCTTCCGCGAGGTCGGCCTGGAGCGTTGGCTCAACGGGCTCGATCTCGAGGGCCACGACGCCGCCAAGAA
GCTGGAGAAGCGGAGGCAGCGTTTTGAGCGCCGCCGCAAGCGCCAGGAAGACCAGCGCAACGGCACCGCCGACGCCACCG
GCACCCACCGCATTACCAGCGGCACCGGCCTCCACCAGTCGACCTTCCGCTATGGTGGCGCTGATGCGCTCGATCCCGTC
GACCTCTCGGACTGCGCCTCGGACGACTCGCCCTCGGACGACGAGCAGCCCGAAGCCACCGGCCAGATCAAGGTCGCCAT
GTTCCGCGTGCTCGCCTCGGGCGAGATCAAGAAGGGCGAATACTCGCCCCAGTTCGATGCCCACGACGACGACGACGATG
CCGAGGGCGCCGCAAAATCGGGCGGTGCCGCCGTCGAGTCCGATGTCGAGCATACGACCAGCTTTGCCAAGCCTAAGAGC
CTTGATCCTAAGACTATCTCGACGCAGACCGTCACCGGCATCGACGGGCCAGACCGGCCCTATGCCACCTTTACCTTTTT
CTACCGCGGCGAGCGTGAGTTCCTGTTCTTCCTCTTTTACTCTCCTCTTCTCCTTCTTCTTCTTATTCGTCTTTCCCTAA
CAATGACAGGCCAACTACAAAAGATGGGCGTCATACCATCAGCCAAGGGCCAACAGACAGCGTCGACAACCAGTAACAAG
CGCCGGTCTACGCAGCTCGACTTCACTGGCATCGGATCGCTCAAGACCGGCGGCACCGTGAACTTCTCAGCCTTCCGGGA
CCAGGAAGCGGAAACGGCTCGGCGGAAGATCAAACACAAGAAGAACAGGAGCAGCATCGGGGCCATGACGATGGATGAAG
ACAGCGACGATGACGACGATGACGACGACAAAATCATAACGATCTCGGGTGCGGATGACAAGGATGACAAGGACGACAAG
GACTTTATCAAAGCATCAGACCGGTTGGGGCCCGACGACGCCAAGTTCACGGGTGAGCTTGCGGACGGTGTCAACCGCAT
TCAGGTACGTGTCTTATGGGTGTGAGCCTGTCTCGCTGCATCTTTTAACAAGCAACAGCTTAAGCGACGGCACTCCGCCG
AGCCGGACGCCTCACCAAGCGATTTCCGCAAGTCACCGAGCACCGGCGATCAGACGCCCGATCTGAATGCGGCCGGCACA
GCAGGAGCAGCACCAGGGGGGGTGTCAGGACTGGGAGCAGCATTGGCAGCAGCAGCCGGCATCAGCGCCGGCATGTCGAT
GGCCGCGCCAGGCGCAGCATCGAGTGCAACTGCCGCCGCGTCGGGTGCATTAGGGACGTCGGTGCTGTTTGGCAAGAGCC
TGCCAGACGACTCGATCATCGGCAGTCCACTGAAGAGGCACCGGGCCAGCCTGGCCGAGGGACTCGAAGGCGAGCAGCGG
TCCGGGCTCGGTTCTTCCTTTCCACCGGCATTGGGCGACATACTCGCAAAGGCAGAGGCTGCGCAGAAGCAGCAGAGCCA
AACATCATTAGCACCAGCAGTCAAGGAAGAGGACGAGGAGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62