GenePrediction:GLEAN_487 Details

Name: GLEAN_487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:134663..135093 (+ strand)
Length: 431
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:134663..134695 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_97:134764..135093 (+ strand)
Length: 330
>GLEAN_487 class=GenePrediction position=GCSC_97:134663..135093 (+ strand)
ATGGCTTCTGCTGCTACCGAGAAGACAAGCAAGGTGAGAAGGCCGTGTTCAGGGGCATCTCGCCATCGCCCCGTAAACTG
TTGTCACTAACCCCGATTTAGTGGGATGCAGAGGCACACATGGCGCTCTGCACCGCGCTGACCAAAGCGCTTCTCGATGG
CGGAGACTCGCTTGCCAGGCATAGCGACGTGCTCATGACATCCATGAAGGCCAGCGGCCAGGATTTTACCTGGGAGGCGA
TCCGGCAGGTTTTTGCTGTATTTGTTGTTTTCGCTTCTGTCTTGCCGCGTGCACTTGTGCTGTTTGATTTGTCCATTGCC
CCTCTGCTATATGCTTGTCTTCTCTCTCCTTTCAGCCACTTCTCCCTTGCCCTTTACAACATCGACAACTGCCCATCCCG
GTTACCAGCATCTGAACCCTTTCTAATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62