GenePrediction:GLEAN_4881 Details

Name: GLEAN_4881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:814406..812700 (- strand)
Length: 1707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:814406..812933 (- strand)
Length: 1474
Type: CDS
Source: GLEAN
Position: GCSC_89:812863..812700 (- strand)
Length: 164
>GLEAN_4881 class=GenePrediction position=GCSC_89:814406..812700 (- strand)
ATGAAGGCATCCATAGCCAGCACACCGCTGCTTCTGCTCAGCTACCTATCGCTCAGCCAGGCCGCCGCCGTTGGCCGGGC
CGGACAATGGCACAGAAGGGACCTGCCGTCCGCAGAGAACGAGCTGAAAGGCAACGACGGCCATAACAACAATGGCGCAG
CGGCGGCAGCAGCAGCAGCAGCACTGGCATCAGATGTGGCAGCAGCATTGTCGGCAGTGGCGGCAGCAGGATTAACAGGA
CACGGGGCACTCACTACGATCGCCTTCGAGGGCACAACTACCAAGGCCAAGGGCAGTACGAAGACAACAGACGGTGGCAA
GAACACGGCCAAGGACAGCACGAAAACGATAACCGACTTTATCAGCGTAACGGCGACTGACGGCACAGCTGCTGCAACGG
CTGACTCGAAGACGACCAAGAAAACCAAGACCAAGGCGACATCTGCCGCTGCTACTGCTGCTACTACTTCTGCTGCTACT
ATTGCTCCTACTTCTTCTGTTTCTACCACTGCTAGCACCTCGACCAGCAAGGTTGTCGCAGATGGCGCTGCCCAGGGCAC
AGCCTCCGCGGCGACAACAGTGGCGCCAACGACAGCTGAAACCACTGGACCTCATGGCGGCGTGGGTGTGTCGGTGGTGT
CGATAACAGAGGCAACGGCTGCGACGACATCGACGGCCGTGACGCCGGTATCGACAACATCGACAACGCCGGCAGAACCG
TCCACCACGGAGTCAACTGTGGCAGTGGCATCGACACCGGCGGCGACGTCAACGGCAGCTACGATTCAAGCAACCCCAAC
AGCCTTGGCAACATCGGTGGGTTTCTCGAACACAACGACAGCGGCTTCTGCAACGGAGGTGGCAACATCAACAACAGCGG
CTGTGGTGGCAACAGCATCGAGTGTGGCCCCGATAACTTTTACCAATTCGACGACTTCGGTTGCTTCGGTTGCTTCGGTT
GCTCCGGTTGCTCCGGTTGCATCAACTGCTTCGGTTGCTCCAGTTGCTTCGATTGCATCAACTGCTTCGGTTGCTCCAGT
TGCTTCGATTGCATCAACTGCTTCGGCTGCCTCGGTCGCTTCGGTTGCTCCGGTTGCTTCAACTTCAGTTGCTTCGATTG
CTTCGACGTCTGCCTCAACTATCTCGACCACAATTGCTTCAGTCGCCCCAATTGCTACAACTGCTACAACTGCTTCATCC
TCGATTGCCTCTACTTTCCCAGCCTCAACTTTCTCGACCTCCATTCTCTCGACTTTTTCGACCTCCACTCTCTCGACCTC
CATATTCTCGTCCATCCCGACCACCTCGACCTCATCCTCCCTGGTCATCTCAGTCGCCACATTTCCCTCGATCCTCTCGA
CCTTGGACGCCGCAACCAGCACTGCGCCTAGCACCGCTTTCGCAATCACTACGACAACGGCGGCCGTAGGCGCTGCCCTT
GTTCCGTCTACCAGCACCGTTGCTGCTGCTGCCAGTAAGTGATGCACAAGACCACAAGACAAACCCCTGGATTGGCTTGC
TAACAATATAGCCCTCCAAACAGCACTCGTCCTCGGAATGGAGGGCGCGACCACGACGGCAGCGGCGGGAGCAGCAGCAA
CCTTGGGTGTCGCCAACGGTGCGCAAGCAGTGTCGATCGACTTTTCCGGACTGTCGCTCACCGATGTGCTGACGTTGGGC
AGCCTGGCAAAGTCGACGGGTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62