GenePrediction:GLEAN_4882 Details

Name: GLEAN_4882
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:809811..808325 (- strand)
Length: 1487
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:809811..809649 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_89:809576..809145 (- strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_89:809088..809024 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_89:808972..808902 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_89:808847..808613 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_89:808549..808325 (- strand)
Length: 225
>GLEAN_4882 class=GenePrediction position=GCSC_89:809811..808325 (- strand)
ATGACCAGCACCGCCCTGCCGACAGCCACGATGGCGAGTCGCAAAGTGCCCGAGACGAAGCAGGAGAAGCTTGATCTCAT
GTACGAGAACCTGGCCGAGATCATCAACCCGGAGATTATCGAGAAGGTCCTGGACGAGGGCCGCAGTGTGAAGGTGTACT
GGGGTGAGTAGATCAGGAGAAGAGAAGGAAGAAACAGAAGCAGAAGCAGAGCAAGAGCAGACGCTGACCTCGCAGGAACG
GCCACGACCGGACGGCCACACACCGGCTATCTCGTGCCGGCCATCAAGATCGCGCAGCTGCTGCACGCGGGCTGCGAGGT
GACGGTGCTGCTGGCCGACATCCACGGCTTCCTCGACAACCTCAAGGCGCCGCTGGAGCTGGTCGAGCATCGCACCGACT
ACTACCAGTGGACCATCCGGGCCATGCTGCAGGCCGTGGGCGTGCGCACCGAGCAGCTGCGCTTCGTCCGAGGCTCGTCG
TACCAGAAGTCAGCCGACTATGTCATGGACGTCTACCGCCTCTGTTCCGTCACGTCCGAGCACGACGCCAAGAAGGCCGG
CGCCGAGGTCGTCAAGCAGACCAGCAACGCCCCCCTCAGCGGCCTGCTGTACCCCATCCTGCAGATCCTCGACGAAGAGC
ACCTCGGCGTCGATGTCCAGTTCGGCGGTCTGTCTCGCACACCCCCCGGCTGCGTGCTCCGTGCTGACCCGTCTTCTGTC
CAGGCGTCGACCAGCGGAAACTGTTCACAGCCGCCAAGGAGTGGCTACCCAAGCTGGGCTACCGCCAGGTAGGAGTCTAC
TCTCTCTCTCCCTCTCTCTCGTCCATGCTGACGGCTTAGCGTGCCCACATCATGAATCCCATGATTCCAGGACTGCATGG
TGGCAAGATGAGCTCCAGCGAAGAAGGCAGGTCTCTCCCTCTCCCTCTTCTCCTGGACATACCTTGTTGACAGCTCGCAG
ACAGCAAGATCGACCTGCTGGACACTCCCGAAGTCATCAGCAAGAAGATCCGCAAGGCCGAGGCCGCACCAAAGGTCGTC
GAGGGCAACGGCATCCTGGCTTTCATCGAGTATGTGCTTTTGCCGGCGTCAGAGCTGCGAGGCGCACGTCTGTTCCGCGT
TGAGCGCGAGCGGGACGGCCTCGAGCCTCTCGACTACACCGACATCAAGAAGATCCACGAAGACTACGAAAATGATGTGG
TACGTTTGGCTTTGCGTGCATTTCGTACTTTTTTGGTGACAGGTGCTGACACTTTCCCGTAGCTCACCCCTCAGCTTATT
AAGCCGGCTGTAGCCAAGGGCATTGTCGAGCTCCTGGCGCCCATCCGGACGGCCTTTGCCGAATCCAAGGAGTGGCAGGA
GGTGGCCCTCAAGGCTTACCCGCCGCCCAAGAAGAAGGAAAAGAAGCCAAAGGACAAGGGTTCACACTACCCCGTGCGTC
CCAAGGAGGAGGCTAAGGTGGAGGTCAAGGAAGCCGCACCGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62