GenePrediction:GLEAN_4883 Details

Name: GLEAN_4883
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:799853..798713 (- strand)
Length: 1141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:799853..799821 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_89:799744..798713 (- strand)
Length: 1032
>GLEAN_4883 class=GenePrediction position=GCSC_89:799853..798713 (- strand)
ATGGCGCAGGTCAAGGCCCTTGACGCCTTGGAGGTTCGTCTGGCTTTCCCAACCTAGAAGCCTAAGAGATCTCGTTATCC
AAATCTGACCTTGCTCACTCTTTCGACAGCCGTTTGTGGCCCTCGCCAAATCGGCCACGTCCAGCCGCGCTGCCGTAGAC
CTGGTCGTGCGCGCCACTTCCCATCCCGGCACATACATCTTCGCCGAGCTACTGCAGACGCCCGAGGTGCAGGCTCTAGC
CAACGCCAATCCCGAGCATGCTGTCTACCTCACCCTCCTCCAGATCTTTAGCTACGGCACCTACGCTGATTACGAGCGTG
GATCGCTACCGAGCTCATTCTCTCCGGATTCCGAGGCAGCAACAACGACACCATCCGCCCCACTGCCGCCGCTCAGTGAA
ACCCAGGCTAGCAAGCTTCGCCAGCTGTCGTTGATCTCGCTGGCCACCGACCGGGCTAGCTTGGCCTATGCTCACCTCGT
GACCGAACTGCGGCTGACCAGCGCCCGCGAGCTCGAGACTCTCGTCATGACAGCTGTCTATGCCGGCCTCGTGTCTGCCA
CGCTCGACCCGGCCCGCGAGGTGGTGCGCATCAGCTCGGTCTCTCCGCTGCGTGACCTGGCCCCGGGTGCCGTGCCGAAG
CTGCGGGCTGCCCTCCAGACCTGGTCCGGACGCTGCGAGGCGACTCTGGCCGATCTGGACGCCCAGATCGCAGCTATCCG
CCGCGCTGCCGTGGCCAAAGCAGAGGAAGAGCGCCGCTGGGATGCCCGGTTCAACAATGCCCTAGATGATGAGAGGGCGA
AAATGAAGCAGTCCGATTTGATGGGATCGTCACAGCTGGGCGCTGGTGGTGGCGTCAGCGCGTTTCTCTCCGGTGGGTCT
TCCTCTGCGTCCACCTACGGAAAGAAGGCGATGACGCTGAACATGTCAAATTCCAGCGGGCCGCGTGGCAAGCCGCGTTT
CATGAAGAGAAGCAGCAATCTGATGACGGACAACGGAAGTAATGGTGCAGCCGGTAACAGCACCGACACTGCAGGTGCAC
TGAGTGGCAGCGCTGCGGCAGATGATGACGAGGGCATGGACCTTGATGACGAGGACGGCGATACAGAAGCAAACAAGAGG
GCTAGTCGGCGGAAACTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62