GenePrediction:GLEAN_4884 Details

Name: GLEAN_4884
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:796009..795420 (- strand)
Length: 590
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:796009..795929 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_89:795795..795721 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_89:795623..795420 (- strand)
Length: 204
>GLEAN_4884 class=GenePrediction position=GCSC_89:796009..795420 (- strand)
ATGTCCTCGAAGAAGCCCACTGGCCGTTCGGCCATTGCCGACGTTGTCGCCCGCGAGTACACGATCCACCTCCACAAGAG
GGTATGTTTATGATGCGCCCATCTCGATGCGAAGGCCGAGGGCGGCTGCGATGGGCCGACGATGACGATTGCGCCCAGAC
AATGCAGCATCGGGCTGGAAATGGACGCGACCGCTGACCTGGGGCATTTTCTAGTTACACGGCGTTACCTTCAAGAAGCG
GGCGCCGCGGGCCATCAAGGAGATCAAGAAGTTCGCCTACCAGGCTATGGTACGACCTCACCCCTCTCCCGACGGTGCAA
TGGATTCTGGTTCTGCCTGTTTGTAGTTTCCTATTGGTGGGGGTGCTGACCAAATTCTCTTTTCAGGGCACGACCGATGT
CCGCCTGGACCCCCAGCTCAACAAGAAGGTCTGGGAGGCTGGTGTCAAGGGTGTTCCCTTCAGACTGCGCGTGCGCATCT
CCCGGAGACGAAATGACGAGGAGGACGCCAAGGAGAAGCTGTACAGCTTCGTGCAGGCCGTGAACGTCAAGAACGCCAAG
GGTCTCCAGACTGTTGTGGTCGAGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62