GenePrediction:GLEAN_4886 Details

Name: GLEAN_4886
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:793687..791851 (- strand)
Length: 1837
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:793687..793685 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_89:793623..793553 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_89:793498..791851 (- strand)
Length: 1648
>GLEAN_4886 class=GenePrediction position=GCSC_89:793687..791851 (- strand)
ATGGTAAGTTCTTGCATCCCTGCATCGTCTTGACGAGGCTGACGGGCAGACGCAACAATCGCAGCTAGACCCGCTGCCGA
GCGACCTGCCGTTTCGCATCGTATCGGACACGATCGGACGGGGCGCCTTTGCTTCGTAGGTCCCGTTCGGTCGCGGCTCT
TTGCTGAACTTCCGGCTGACACGTTGCAGGATCAAGAAGGCGATGCCGCTGGCGGACAGCCAGCCGGTGTTTGCGGTCAA
GCTGATCCACAAGGCGTACGCGGTCAAGAAGGGGCGGATCTCGCTCAAGCAGATCACGACGGAGGTGGCGCTGCACTCGC
ACGTCGGCCAGCACGCCAACGTGATCGAGTGGTTTGCCACGGGCGAGGACGCGGTCTGGCGCTGGATCGCCATGGAGTAC
GCCGAGGGCGGCGACCTGTTTGACAAGATCGAGGCCGACGTCGGCGTGCCCGAAGACATTGCCCACCTCTACTTCCGGCA
GCTCGTCGGCGGCATCAGCTTCATCCACTCCAAGGGCGTGGCCCACCGCGATCTCAAGCCCGAGAACATCTTGCTCGACG
GTCGTGGCGACCTGAAGCTGGCCGACTTCGGCATGGCCACCATGTTCGAGTACAAGGGCAGCCGCAAGCAGAGCTCGACC
ACCTGCGGCAGCCCGCCGTACATTGCCCCGGAAGTGCTGGCCTGCTCCGTTCAGGAACAGCCACCGACCAAAAAGTACGC
GCCCGACCTCGTCGACATCTGGTCCGCCGGCGTCATCCTCTTCGTCCTCCTCGTCGGCAACACACCCTGGGACGAGCCGG
TGACGACCAGCTGGGAGTTCCACGAGTACGCCCGCACCGGTGGCCACAGCTCCGATCCGCTCTGGCAGCGACTCCCTCCG
TCGGCCGTCTCGCTGCTGCGCGGCATGATGAGCATCGACACCGCCCGTCGCTTCAGCTTCCACCAGATCCGCCAGCACCC
CTGGTTCACGCGTCCGAACCGCCTGCTCACCGCCGATGGCCGCGTCTCCGACCCGCTCGAGCTGGCCACCCAGATGCTCA
GCAACCTGCACATCGACCTAACTCAGGCTTCCATCGCCCAGGCTGCCGCAACAGCCGCAACAGCCGCAACAGCCGCAGAA
ACAAACCATGGCCCAGCCCTGGCTTCCACCCAGCCTGAGGTGCCCATCCACGACGTCGCCTACGACTGGGAGCGCCCAGG
CCTCCGGGCTGCCGGCCGCTTTGCTGTCTCGGCCACACAGCCCGTCTCGCGCGCAGACGTCACGCCGGCCGACTGGATCG
ACAGCAACAAGGCCAAGAACAAACACTCAAACACAAACATCTACAGCCTGCGCGAAGCCCTGGCCGAGGAACCTGCCATG
AGCCAGTTCTCCCAGACCCGTGGCCTGCCCCTCTCTCTCACTCAGCACGCTCGCCGCTTCCAGGACATCGTGCCGTCCTA
CTCGCTCACCCGCTTCTTCTCCCATGTGCCGCCGGCACTGCTCGTCCAGATGCTCTGCGCTGCCCTCCACCAGCTCAACG
TCTCGGCACCCGCACCTGAGGCTGCCATGGCCGCCACTACGGCCGCTCGCAGCGAGGCTGTCGCCCGCATCCACGTCCGT
GTTGTTGACGGCCGCAGACAGTCCCTCCATGGCGAAATCGCCGTCGACTGGTGCCAGCTCGCCCTTCCCGGCTACGGTGA
CGACGGCTCCGAGCTGCAGCCGTCCCAGCTGCTCGAGGTCCGCTTCATCAAGTACAAGGGCGATCCGCTCGAGTGGCGTC
GCTTCTTCAAAAAAATGGCCCAGCTCTGCTGCGACGCCATCTACTCCCCCGAAGACGGCTCGGCCGCCGGCCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62