GenePrediction:GLEAN_4889 Details

Name: GLEAN_4889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:774357..769501 (- strand)
Length: 4857
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:774357..774043 (- strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_89:773986..773369 (- strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_89:773319..773059 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_89:772992..772072 (- strand)
Length: 921
Type: CDS
Source: GLEAN
Position: GCSC_89:771975..771390 (- strand)
Length: 586
Type: CDS
Source: GLEAN
Position: GCSC_89:771338..769501 (- strand)
Length: 1838
>GLEAN_4889 class=GenePrediction position=GCSC_89:774357..769501 (- strand)
ATGCACGATGATTCCATGATTGTTGGAGTTGGCACCGCCTTGGCTGTCATTGCCCTTTCTACCTATCCCGCAGTGTCCGG
TCTGGTCCTGCAGGTCTTTAATCGCCAGCCGCGCGATGACGCCCTGTATGAGGATGCCGATGGCAAGGCTACGGCCGCCT
CGGTAAAAGCCTTCACTGCCAAGCTTCCCAAGGCTGCCATCTTTCTGTCGGCCGTCCTCGGCTCTGCCGTCTCGCTATCG
GCCTCCATCCTCGTCACCCTCCACCTTGCCCACGACGGCTTCCTCGTCGAGGACTGGCTGGCTACTGCTGCCTGGGTAAG
TCGCTCCTAGTCCAGACAGAAGACGTCGGATTGTGTTGCTGACAATGCTAGAACCTCATCCTCCTCCAAGCCATTGCCAT
CGTGTTCACCCGAAACTCGACCCGGGCGTACAGCTATGGACTTTATACTTTCACGTCCGGCCTGTTGCTGTCTTTTGTCG
TTCTCACCCAAGATTCTCAGGTTTTGGATGAAGTGCTGAATGAGTACCCGGTGCTCTTCGGCCTCCGTGTCGCCGAAATC
GTCGCCATCGTCGGCGTGTGTATGGCAGGCATCTTGCTGCCCCGTCGCCCGGATGTCTACTTCAAGGACGAGATGGTTGA
TCGCATGTACAGCACCAGCGCTTACGGCCGCTTCACCTTCTCCTGGTCCAACGACCTGCTCGGCCTGTCGACGAAGAAGC
AGACGCTGGATCTTGACGATCTGCCTCGCCCTGACCACAACACCCGGTCCGAGGACGTTGCGCGTGTTTGGAAGGAAAAC
GGCTACTCGTCCGAACGCCTCTGGCTCTCCATTGTTCAGGCACACGCATTCGATTTCGCCATGCAGTGGGTTCTCACCAT
CATCGGTGCTTTTCTCAACTTTGCTCCCCAGTGGGTTATCCTCCAGCTTCTTCGTATTCTTGAGACTCGAAGCAGCGACG
AGGCTAGAGGTATAGATGTCTGGATCTGGGTCCTGTGGCTAGGAGTGTCCATCATCGCACAATTTGTTTATGAAACAGTT
GGTGGAGTCGTACGTCTTTTGGCTATCGTGGGCCGAGCTCGCCATTCCGATTCGTGCTCAGCTATCTGCCCTGATCTTCG
AGAAGGCCATGCGGAGAAAAGACGTCAAGTCAAACAAAAAGGCGGCAAAGGCTGCCGTGGCTGATTCCAGCATCGCAGCC
AACCCTACCGAAGCGTCGGCCGAAGACGAGGGTGAGGCTGGGGATGATGAGCTCGAGTCGGCCAAAAAGACCAAGCAGGG
CACGGTCAACCTGATTGGCGTCGACGGAAAGCGGGTGTCCGATTTTTGCTCGTTCTAGTTCCTCTTCCCTTCTAGCTTTT
TCAAGCTCTTTGTGTCCCTGGCATTCCTGGTGCAGCTTCTCGGCTGGATTCCCCTTCTGGCCGGATTCTCGGCCATGGCC
ATCATCATGCCCGTGAACATCAAGTTCTCAAAGAAGTACTCCGATGCGCAGGACAAGCTGATGAAGCTCCGGGACGAGAA
GCTTGCTGTTGTGACTGAGGCGCTGCAGGGCATCCGCCAGATCAAGTTCTCCGCTCTCGAGCCGCAGTGGGAGGGGAAGG
TGGGCGAGGTGCGCGACCGCGAGCTCAAGAGCGTGTGGAACGTGTTCATGTTCGACACGGCGCTCATGGCCTGCTGGATC
ACCAGTCCGATCGCCCTGTCTGCGATCTGTCTGCTTGTGTATGCGTATATCCACGGCGAGCTGACTCCGTCGGTTGCATT
TGTCAGCTTGGGCATCTTCCGTTCGCTGGAGACGACGTTATCGGTCGTGCCTGAGCTGACGACCGATCTCCTTGACGCAT
GGGTCTCCATCAAGCGTATCGAAGACTACCTCTCTTCGCCAGACATCGACAAGGTGGCCAAGGACGGCGATGTCGTTGTG
TTTGAAAACGCGACCATTGCGTGGCCGTCGGAAGAGAAGCTGGAGGATAGCGAGCACTTTATTTTGCGCGATCTCAACGT
CACATTTCCGGCAGGCGAGCTATCCATCATCTCTGGCAAGACGGGTTCTGGCAAGAGCCTGCTGCTGGCTGCCATTCTGG
GCGAGGTTGATCTTCTGGCCGGCTCCATCCAGGTACCGCACTGTCTGCCCATTGCCGAGCGTCACGACGAGAAGGCGACC
AAGGCCAACTGGATCCTGCCCAAGTCGATGGCGTTTATCGCGCAGATTCCGTGGATCGAAAACGCAACGATCAAGGAGAA
CATCGTCTTTGGCCTTCCGGTTGACGAGGACCGGTACCGCAAGACGGTGGACGTGTGTGCGCTCAAAAAGGATTTGGAAA
TTTTGTCAGACGGCGAGAATACGGAGATTGGCGCGAACGGCATCAACCTGAGCGGTGGATAGAAATGGCGCATCACGCTG
GCGCGGGCAATCTACTCCCGGGCCGGCATTCTGATCATGGACGACATCTTCAGCGCGGTCGATGCCCACGTGGGTCGCCA
CATCTTTGAAAAGTGTCTCACCGGCGAGCTCTGTGCCGGTCGGACACGCATTCTGGTGACGCATCACGTTGCGTTGTGTG
CGCCCCGGACCAACTTCTTGGTGGAGCTGGGCGACGGTCGCATCGCTCACGCGGGCCTTCTGTCGGAGCTAGCCAGGGAC
GGCACGCTGGACCAAGATTCAAAGAGCCACGTGGAGACGGCCGAGGAGGCGGCTGAGGACGAGACGGTCGACGCGACGGC
AGTGAACTCGGACAACAGCACAGACAGCGGTGAAGCCGACGGCGGCAGTGCCCTCGACAAGGTTGCGTCCAGGGCGACAC
AGCCGCAGGAGCCGGAGCGCCAGGCGCGGAAGTTTGTCGAGGAAGAGAAGCGTGAGGAGGGAGCTGTGCGCAAGCATGTG
TACATGGCCTATCTCAATGCCAGTGGTGGCTGGGCGTTCTGGACCGGGGCTCTGGTGTTCTTTCTGCTGTTGGAGCTGAA
CGCGATTAGTAGGTGATGCTGGCTCCGTTCTTCCTGTCGTCTCGCTAACGTGTTTGCAGGCCGCTCATGGTGGCTTCGGA
TCTGGACCGGCCACTACCAAGGCGGTGATGAAGAGACGGTGCTGAACCTGTCAGCCATGGGTCTTTCTGCGTTGAGCCAA
CGATCCGTGGTCCAGCAGTCCGCCGATCTGCAGTATTCGTATGGCCTCGATCAGCCTGTGCTGGCCGGCTCCGGTTCCGA
GTCGGGCTCTCACTCGTCCCAGTACTATATGACCATCTATGTGGTGCTTGCGGGGATTTCGGCACTGTTTGGCTCTCTGC
GCTGCTACTATGTCTATCGCGGTTCGATCCGGGCCAGCAGGACGCTGTTTGCAAAGCTCAACTTTATCATCCTGCGGTCA
CCCCTCCGCTGGCTCGACACGGTGCCGGTGGGCCGGATCCTGAACCGGTTCACGGCGGACTTCAACACGATCGACACGCA
AATGGCCAACTCGATCAGCTTTGGTGGCGCAGCAGTGATCCGCGTGTTCGGCGTGATCATCGCCGGCCTGATGGTGTCGT
ACTTTGTGGTGCTGCTGTCAGTGCTGCTGCTGCTGGCCTGCACGTACTTTGCGTTCCTGTACATCGCAGCGGTGCGGCCG
GTCAAGCGGCTGGAGAGCACGGCCAAGTCGCCGGTATTTGAGCAGTTTGGAACGGCACTCTCGGGCGTGGCCACGATTCG
CGGTTTCGACAAGCCGAGCGTATACATTGAGCGCATGTACCGGCGGCTGGACGACTGGTCGACGACGACGTGGCACATGA
TGCTCTTCAACCGCTGGGTCGGCTGGCGAATGAGTCTGGTCGGATCCTTCTTCTCGGTCATGGTGGCGGCCATCGTGCTG
TCGTCCCCGCAGATGGACTCGGCCCTGGCTGGCTTCGCGCTGGCTTATGCCATGGAGTTTGCAGCGAGCATCATGTGGGC
CGTGCGACTGTACGCCAACGTGGAGCTGCAGATGAACGCGGCCGAGCGCATCATCGAGTACACGGAGCTGTCGACCGAGT
CGCTCGAGGGGGGCAGTCCGCCGGCTGCCTGGCCGACAGAGGGTCGCATCGAGGTCGACAATCTGGTCGTCAGCTATGCG
GCCGACCTGCCGCCAGTGCTCAAGGGCGTGTCCTTTGACGTGGACCGCTGCCAGCGTGTCGGCGTGGTTGGCCGCACCGG
TGCCGGCAAGTCGTCGCTGACCCTGGCTCTCTTCCGCTTCCTCGAGGCCCAGTCGGGCAGCATCCACGTCGACGGTATCG
ACAACAGCAAGATCAAGTTGCACGATCTGCGCTCGCGTCTGGCCATCATCCCCCAGGACCCCGTCCTGTTCTCGGGCACC
ATCCGCACGAATCTGGATCCCTTTGATGCCTACACCGACGCTGAGCTGCAGGACTGCCTCGCGCGCGTGCACCTGACGAC
GCCGGTGTCCGACTCTTCCGCGTCCGCAGCCTCGGCCTCGTCGGCCGTCCACAATAGCAACATCTTTGACGACCTGCAAT
CTTCCGTGTCGGAGGGTGGTCTGAACCTGTCGCAGGGCCAGCGGCAGCTGCTGTGTCTGGCCCGCGCCATTGTGCGGCGA
CCTCGTGTCATGGTGCTGGATGAGGCCACATCGGCCGTCGACATGCACACCGATGGTCTGATTCAGCGCAGCATCCGCGA
GGAGTTCACCGGCGCCACCCTGCTGGTCATTGCCCACCGCCTGAGCACCATTGCCGACTTTGACCGCATCCTGGTGCTTC
AGGACGGCACCGTGGCCGAGTACGGCTCACCGCGCGATCTGTGGGCCAAGGGTTCCGACCACGGCGTTTTCCGTGCCATG
TGCGAAGAGAGCGGCGAACGCGACAGGCTGGAGAAGGTCGTGCTGGGCGAGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62