GenePrediction:GLEAN_488 Details

Name: GLEAN_488
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:135154..137026 (+ strand)
Length: 1873
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:135154..135305 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_97:135985..136084 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_97:136368..136570 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_97:136685..136924 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_97:136984..137026 (+ strand)
Length: 43
>GLEAN_488 class=GenePrediction position=GCSC_97:135154..137026 (+ strand)
ATGCCTGTCAAATGGGACGACAAGGCGATGCTTGACCTGTTTATGGTCGTCCTCTCCGTCACTAGACCATCGCAGTTCTC
CCCAGAGCAAAAAGCCGAGATCGTCCAGGAGATGAAGATCCGCGGCTACGATATCGTGTGGAACGGAATACGGTACTGCT
TTTTTTACACTGTTCTGTGTTGTCGTGATTTCACTCTGCGTCGTTCTTGTTTTGAACTGCTTTCTTCGAGTACTGATTTG
TCCCGTCCGTGCTTTTGACTTCACTACATTGCTCCTATTTATGGAGATCCCTCCCACCTATCTCCGTATCAATTTCAACT
TCACTGTCCCTTTTCCCAAACTCCCACCAATCTGCCATCCACCCTCAATCCTGGCGGGATATCACAGCTTGTCTTGAGTT
CAGCCTCTTTCAACTGCGCTTACACTTTATCCGAACATCCGCACAACTACAGCCATGTCCAAGTGGGAAGGCACCATGAA
AGATGACCTCTTGCAGGCCTTTTTCAGTCATACTACCCCAGATACAGAGCAAAAGCAGAAGATTGTTTCCTATCTTGAGA
TCAAGGGACACACTATCACATGGGATGCCATACGGTACTTACATTTCATTGATTTTTCCTCACGCTTGCTCCTCCTACAC
CTATATTATTTTATACTCGCCTGTTGCTCTAAGTCTGTTCCCGGCTTCACTTCGGTCCATCCCATCTTTCAGCTGCCACA
GCAACGACAAAAACCATACCCTGTTTCCTGTTTGTTTATTTTCCCATCACGTCCCATCTCACCACACTCCCTTTTCCCTT
TCACGCCATCACCTCCGACCATGGCCACCAGATTGCATCGTCAGGACTGGGACGCTCCCGGCCTGTACAAGGACCTTCTA
GCCTCTATGGCCATCGCGTGCAAGCCTACGGCTGACACCCTGAAAGAGGTTGTCCAAGATATGAATCTGCGTGGCTACCA
GTTCACTTTCCATGGACTAAAGTATTCCTAGTCCTACCCCAATTTCCAGCCTCTGCTTTGTTTACACAATTTCCCGTCTG
TTTGTGCTCAAAGTCCGTCTTTTGTTCTTTTCAGCATACCTGCCCCTCTTTCTATTCCTCTATTCCATGAAAATCAATAT
AAATCCCCGAAAAGCACCCCCCGTCTCATCTTCAATCTTGTCGATCGATCTTTTTCCGGGGCTCGCATGTTCACTCTCAC
ATCCAAATCACCAGTCATATCACCTTTACGTCAACTTGACTTCAACCCCTCTCATCTTCATCACGATGGCAACCAATCGA
CAGGCATGGGATGGAGATGCTCATCGCGACCTTCTCATAGCCATGGTCGACGTGCTTTCGCCTAGTGGCGAGCAGATCCG
CAATATCGTCGAGCGCACCACAACGATGGGCTACACCTATACGCCAAAGGCTGTTGTGTACTCACCCTCTCTTTGTTTCT
TTACGTTTCATCTCGTGCTATCCTCCTTACGCGTCTATCTTTCGTGTTCACCTTTTACCATTCTATAGGCCTTTTACTAA
CGTTTCATTAGCCAGCATTTGCAAAAGCTGAGACGCAGTGCAACCGAGGGCGGTGCATCCACGGCATCCCCAAAGACGCC
GAAGCAAAAGGCGCCACGGACGCCCAAGAAGTCAACTGGAAAAACGAGCATCAAAGCTGATCCTAAGAGAAAAGTGGAAT
TTGAAGATGAGTCCACTGTGGACACCCCATCCAAGAAGCCTCGCTTTTCGCAAGAGATTGAGGATTCCGATGACTTCGAG
GTCAAGAAAGAGTATGTTTTAACAAAAATTACGAGATATTTGAGCCAAGACTGACCCTGATCGTGTGCAGAATCGTGGCG
GAAGACAATCTAATCGATTTTGGCGAGCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62