GenePrediction:GLEAN_4890 Details

Name: GLEAN_4890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:765439..764229 (- strand)
Length: 1211
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:765439..764638 (- strand)
Length: 802
Type: CDS
Source: GLEAN
Position: GCSC_89:764329..764229 (- strand)
Length: 101
>GLEAN_4890 class=GenePrediction position=GCSC_89:765439..764229 (- strand)
ATGGAGGACGTCGGCCGCTTCGATCTACAGCTTGACGACCTGTTCGGCCGTGTAACCGAGCTCCTTGAGGGCGCCCGTCA
GCTCGCCCTGGTTGCTCGGGCTCTTCTTGGGGCCGGACACAGCCTTCATCAGACCCGGGGGTCCGCAGACAAACAGCTTG
ATATCGCCCGACGTCGGCTCGGGCAGCACCTCCTTCAGCAGGTCCTTGGTGATGTAGCCCTTGGAGCCACCGGTCCACTT
GTCGGAGGGCGGCTTCTCCAGGACGTAAAAGACGCGGAACTGCTGCGGGTACGTGTTCTCGAGCTCGTTCAGCTGCTTGC
GCAGCAAAATGTCCTCCTCGGCGATGTTGCCAAACACCAGCGTCACCTTGGTCTTATCGACGCCCGGGTTCTTGAAGATG
GCCTGCAGCAGCTGGTACATGGGCGTGATGCCGGTACCGCCCGCCAGCAGAGCAATGTGCTCGTGCTTGTTGGGTGCCCA
TGGGTACTTGGTGATGGGACCCTTGATCTCCAGCTTCTGGCCCGGCACCAGCGAGTGGATGTGCGTCGACATCGGCCCGC
CCTCGTACTTCTTGACGAGCAGATCCAGGTGGCCGACCGCGTCGTCGTCACTGACCGCAGTATACGGCCGTACCACCGGC
TTCTCTGCACCCTCTGGCTTGAATTTGGTCAGCAGCGCCGATGCTGCGTGCATCCCCGACACGCTGTCCTCCTCCGGCAG
CTTGAACCGGAACTGCTTCGTGTTGTGGTTGAGCGTCTCGACGCTCTCCAGCTCCAGGCTCAGGAATCCCTGGCTGCCGC
CCGTGAATGTTTCCTTGTGCGCGCCCGTCACCTCGGATGCTGCACCCGCTGCCGTCTCTTTCGCTGTCGCCGTCACCTTC
TCTGCCGGAGCCGCGCTCGTGGAGTAAAAGTAGTAGCCGCCGCCGCCCGCTGCCGCCGCAGTGACTGCCGCAATCAGCAG
TGTGCTGCTGCCGCTGCCGCTGCTCGGAGAAGGACCAGTCGCATACCGGCGGCAGGATGTCAGCTGCGCAGTGTGTCAGC
TTCGGCCTCCGATTTGTACTGCGGCATTGGTCTGCACAAAATAGACAGCTCCTTTCACCTACTGCCGCAGCTCACGGCTT
CGGCTTACCTGTCTCAGCGGCGCTGCCGACTGAAGCGTACGGAATGCGGTGCGCGCAAACATGGCGACTGTATTTGCAGA
TAAAGACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62