GenePrediction:GLEAN_4891 Details

Name: GLEAN_4891
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:758978..758162 (- strand)
Length: 817
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:758978..758884 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_89:758819..758162 (- strand)
Length: 658
>GLEAN_4891 class=GenePrediction position=GCSC_89:758978..758162 (- strand)
ATGGCTGTCACCAGTGATGCGGCCACGGCAATGCCGAACCCGCCTCACCAGTTCCAGTTGAAGTTTTGCACCGTTTGTGC
CAGCAACCAGAATCGGTATGTGTGGCGGCGAGTTTAACGACGAGTTGTTTGGACTTGGAAACCCTAATACACAGTGCAGG
TCGATGGAGGCACACCTGCGTCTTGGCAAGGCCGGATTCCCAGTCGTTTCCTTCGGTACGGGGTCTCTCGTACGTCTACC
GGGGCCAAGCATAACACAGCCGAACGTATACCAGTTCAACAAGACCTCGTACGATAGCATGTACCGCGAGCTCGAGGCCA
AGGATGACCGGCTCTACCGCGCCAATGGCGTCCTCAACATGATTGACCGCAATAGGGGCGTGAAGTGGGGACCGGAGCGG
TGGCAAGACTGGCAGATTGGCATTCCGCGGCTGGAACATGCCTCGGACCTGGGTAGTATTGGCACCGAGGGTGGTGTTGT
GGACGTTGTGATAACGTGTGAAGAGCGTTGTTGGGACGCCGTGATTGACGATCTACTCAACCGTGGCTCACCGCTCAACC
GGCCAGTCCACGTGGTCAACGTTGATATTCGCGACAACCACGAAGAAGCTGCAGTGGGCGGAGGTGCCATTCTCGACCTT
GCCAACAATTTGAATCAAACTGCTGCCACAGAGCGGGAAAAGGTCGGGGCCGCAAACTTTGATGCAGGCGGCGCTGCCAG
TCGGTCCGGCTTTGATGAGCGCGTCCCCGACATCATTGCTGAGTGGCAAGAGCGGTGGCCTAACTTGCCAGCCACATGGA
CTTTGGCATGGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62