GenePrediction:GLEAN_4892 Details

Name: GLEAN_4892
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:755780..752877 (- strand)
Length: 2904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:755780..754761 (- strand)
Length: 1020
Type: CDS
Source: GLEAN
Position: GCSC_89:754702..753332 (- strand)
Length: 1371
Type: CDS
Source: GLEAN
Position: GCSC_89:753260..752877 (- strand)
Length: 384
>GLEAN_4892 class=GenePrediction position=GCSC_89:755780..752877 (- strand)
ATGAATGGACGCAATGCACCGCTCTCACCCGTATCTTTAGGAGATAGTGACTGGCCCTCTTCCTACCCCATGGACAAGGA
CGACCCGTATGCCAACAGCCGCGGCCAGCTCACCTCGCCGCCCAATTCCGGTGGCCCTGGACCCGGGCAGATGAACGGCT
TTTCGGCCGGGCCGCGAAATGGAGGGCCCTCTCCGCCGCCCTCCATCGGCCGCTCCAGTATCGGCCGCTCGAGCACGGCG
ACAAACCTGTACGCCCCCAGCGAGGGCGGCCAAAGCGCACGCGAAATAGAAATGACCGAGGCGCAGCTGGGCGAGCACTA
TGTCGCCCTCAGGCGCTTCTTGTCGCAGACGTCGCGCGACGGCAAGCCCGCTAACCCCGCAAACAAGGCGCGCGACAAGC
TGCAGCGGCTTACCTCGGTGCAGTTTCTCGAGCTCAGTACCGATGTCTACGACGAGCTGGTACGCCGCCAGACCTTCAGC
CGTCGGCCACCCAACGCGCCGCCAGGCAGCGGTCCGCCGACCTACCTCTTGCCCGAAGACAACTTCCACCCGAAACGGAA
CCAAGCCCGGCAGAAGCTTGCCTCTCTCGGGCCGCCGCGTTTTCGCGATCTCGCCACCGACGTCTTCTGCGAGCTCGAAC
GCCGTTTCCCCCGATTCGTCGACGGTGAAATTCCGCGTCTAGGCAGCCCGACTTCCATTCGCGGTTCCAGTCGAGCGGGA
ACCCCGATGGGTGGCGGCGGCATGAACGGCTTCCCGCCACGGGGCCAGGGTCGGCGGCGACCGTCTGAAGCCGACTCCGT
ACGGTCACTGCGCGGTCCTGGGCCTCTGGGGCCCGGGGGCCCGATGGGGTCGGTACCACCTTCTCCAGGCTTGCCTCCAA
ACGGCTATGATCGGCCGATGCAGAAGCAGTCACAGACAAACACGATCGTGCCGAACAAGAGCACGATGGTAGAAGAGGAC
GACGACGCTACCAGTCCGCTCGACACATCCAAGGCGGACGAGGAGGCGGAGGAAGCTGAGGTATGTGTCTACATGGCTGA
TTTTTGAACCGACCGGCAACAGAGACTGACCTCCCCAGAATGAGAAGAAGCGGATGATTGATGACTACGAATCCCAGTTG
AAGGAGCTGAGAGAAAAGGTTGAGACCATGGAGCTTGACATGAAGCAGCAGAAGGAAGAGGCAGATGCCGCTCTTGAAGA
GGAACGAACCCGCGCATCAGCATCCACCGAGGAGAGCCAAGAGTCCTCCGACGTCCGCCGGGATCTGGAAACTCGGTTAG
CCGAGGCTGAAGGCCTTGCCGAGTCACTGCAGCAAGACGTGGATCGCATGCGCAATGACCATGAAGCCCAAGAACAGCAG
CTTCGCGCACAAATCGACGATCTACAAGCGTCGTTAGCAGAGCGTCCAGAGCTAGAGGCTGGCAGTGCCGGTGGTGGTGC
CGGCGATTCAGAGCTCGCACAAGAAAACGAAGAGCTTCGACAGGCGCTCCGCGAACAGCAAGAAGTCACGGAGGAAGTCC
GCAGAGACGCAGAGCAGTTCCTGCAGGAGATGCGAATACTGTCACAACAGAGCGGCGCAACTTACGAAAAGCATGCCGAG
CTGGAAAAGACGATCGAGACGCTCGAAGCCGAAGTGATAGAGTGGCGCAATCGCTATGCTCGAGCCAAAACCCAGATGAG
GAGCATGCGGGCGTCAACAATGGGGCTGCCACGGAACGATGCAGGCAAATACATCCGGGAGCAGGGCTTCACGGCAAGCA
ACGGTCTGGTCAAGGATGTACACGTGACGAAATTCCAGATAGCCGTGGACGAGCTTCTGCACCACGCACATGTCGACGGA
CCGGAGCAGACGGTCGACGCCATGAAGGCAGTGGTTGTCTCTGTCCGGCGCATCACCAAGGATGTCGTGGGCGGGGCAGG
GCAGCAAGACGTGGAGGTAGTGCAACTGTACAGCAAGCTGAGGGGACGTGTGTCAGCCACGGCCAACAACCTGATCACGG
CCACGAAGAACTTCTCCATATCGGCAGGCCTGTCACCGGTCTCCCTGATTGACGCAGCGGCATCCAACCTGGTGGCCGCC
GTGGTCGAGTTGTTGCAGACGGTGAAGATCAGGCCAACGCCAACAGACGAGCTGGAGGAGGAGGAGGAAGAGGAGGACGG
GACGATAACACCAGTCGACTCGAGTGGCTTCTTCTCGCCACGGAGCAACGACGGGCCCAACTCAGCCACCACCGTGTCTT
CGGCAACGACGCAGGACTCGCTCCCGCCACCGCCACCCTTCCAAGGACTGGGGGGATACCGCAATAGTACGGACTCGTCG
GCGTACAGCCCGGTGAACTCGCCGCGTGAGTCGTCCAGCCAGTACGCCGGCAACTTTCCGGTCATGAACAAGGGCCTTGG
CACGAACGGTCTGAACGACGTGGCGGACCGGCGTGCCGAAGAGCTAAAGGTAGGAGGAGCCTTGCAAGGGACGGAGGCAG
GCTGGTGAGAAGGACGCGTGCTGACCTGACGTGTCGGCAGGCCTTCCTCGACGACCAGACGGCGACAATGGTACAGATCA
TCCAGGAAATGGTGGGGTCGATCCGCGGCGACGCGCCAGTGCAGCAGATCACGGACCAGATCAACGAGATTGCGGACATT
GTGGGCAAGGTGATCGGCGAGACTGAGGCCAGCGGCCATGGCGGACAAGGACTTGATAAGCTGGTGGACTGCCGGCAACG
TCTGCTGGAGGCTGGAGACCAGGGTGACGAGATGATGAACGACACGACGGGCCAGCAGATGGACTGGCGGTCATGGACGA
CGTCGCTGCCACCGATCGCGTTTGAGATTGCGCGTGAGACCAAAGAGCTGGTCAAGCGGGTCGATCGGATCGTGTTGGGC
GAAGGGGCAGAGGATTTCTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62