GenePrediction:GLEAN_4893 Details

Name: GLEAN_4893
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:751377..750442 (- strand)
Length: 936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:751377..751186 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_89:751117..750846 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_89:750787..750442 (- strand)
Length: 346
>GLEAN_4893 class=GenePrediction position=GCSC_89:751377..750442 (- strand)
ATGGCATCTGTCTTTGGCTTCGGCGCCGATTCTGGCGCGCGCACCGTCGGACGCGAGCACTTTCCCGTCTATCCCCGAGG
CTTCTTCGGCCTGCGCATCGCACAGCTGGTCCTCGCCCTGATCGTCCTCGGCCTCGACGCCTACGGCCTGTACAGCCTGT
CCTTTTCCGGGGACGGGCTCAACATGTTCACGGTATGCTATCTGCCTATACGTCACGTCTCCCGTGTGTGATCTGCTCCT
GACTGATCCAACGTCCACAGTGCATCGCCACCGTCATCACCTGTGTCTACCTCCTCGTCGCCGAGCTCGCCGTTTCGGCC
ATCTTCAACTACTGGGCCGCCCTCGGGCTGGACATTTTCTTGGTCGTCTTCTGGCTGGTCTCCTTTGCCTTGATGGCCTC
GCAGGTGGCTCCCTTTATGCGGACGTACGATGAGTGCTACGGCGACTACTGCTACACGTACGCGCTCGACGGTTACGCCA
AGACGTTTGCCGACTGCATGGCTGCCGTGGCCGGACTCGGTGGCTTGGAGTTGTACGTGCCTCTGCCTGCCTTTTCTAGT
CGCCCTGAATACATCACTGACGACAGGCAGCCTCCTCTTCATCGTCAGCCTCGCCATCAGTGGCTTTGCCCTCCACCGTC
ACCGCGCCCTCGGCCTGCACTGCATTCCCGGACAGGAACGAACCGTGGTCGGGGCCGGCGAGAAGGGTGTGCCGGTGGCC
CTGCAGTCCATCCAACCGGCCCAGTCGTTCCAGCAGCAGCCGGCTCAGCCACAACTTCAGCCACAGACTCAGCCACAGCA
GTTCCAGGCCCCGGCCGCCGCCTACAGCCAGACCTTTACGCCGCCGCCTCCATCATCTACTCCCGGCGCCGTCTCGCCCC
AGGCCACATACTCCGGTGTTGCTCCCAATACGACCTACTATGAGGCTCAGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62