GenePrediction:GLEAN_4894 Details

Name: GLEAN_4894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:746376..744096 (- strand)
Length: 2281
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:746376..746307 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_89:746197..745889 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_89:745822..744983 (- strand)
Length: 840
Type: CDS
Source: GLEAN
Position: GCSC_89:744922..744096 (- strand)
Length: 827
>GLEAN_4894 class=GenePrediction position=GCSC_89:746376..744096 (- strand)
ATGGCCATGACCTCCTCTAAGGAACAGAAGACTAAGCCAACGCTGCCAGTCCGACAGCTATGCATTCTAGGTATGTCTGC
CCAACATCCCATACATTTCCTTCTCCAAGTCTTGCTATCATGAGTCATGCTGTTGTTCAGAGCCTCGTCTGTGTGCCCTG
CTGATTCCTTCTCCCACAGCCATCGTCCGGATCGCTGAGCCGCTGGCTCTCACATCCGTCTTCCCCTACCTCCCCGAGAT
GATCAAGAGTTTCGGTGTGCCTCGAGATGAGATCGCAAAGTGGGCCGGCTTCACCAGTGCCATCTTTTCCATCTCCCAAA
GTCTGACCGCCGTTCTCTGGGGCCGCACCTCTGACACCATTGGCCGTAAGCCAACCCTCATTCTGGGCATGATCTGCACC
ATGTTCTGCTTCCTCTTCTGGGGCACCTCTACCAGCTTGGCCATGGCCATCACTGTCAGAGCCATACAAGGCTGTGGAAA
TGGAAATGGTATGTGAATCTTATGTCGTCTACCTTCTGCTTGGCTGTGCCTCGTTTGCTAATTGTGGCTCCTAGTCGGTA
TCATTCGCACCGTTGTTGCCGAGCTGGTCCCCGAAAAGTCCCTGCAGCCCGTCGCTTTCTCCATCATGCCCATGGTCTGG
AGCGTCGGCTCCGTCTTTGGCCCGGCCTTTGGAGGGTTTTTTGCTCGTCCTGCCCAGCAGTTTCCAAGCCTCTTTGGCAA
CAACAAGCTTTTTATCAAGTTTCCCTTCCTGCTGCCGAACCTTATAGCCGGTGTCTTCTTTCTATGTTCTCTCGTGACGG
CAGTTCTTTTCCTCAGAGAAACACTCGCCTCCAAGCAACATCGACCGGACTGGGGTCTGCAGCTTGGTCAGAAGCTGGTG
GGCTATTTCAGCGGTGGGAAGAAGTCAAAGGGAAATCTGCATCGGGCCCGACGGGCAATCCGGGACCGGACCTATGCCGA
CGACGAAGCCAGCGCTCCGCTACTGTCAACCCCCATAATGGACCCTGATGACACCGAAATCTCCCCAGACGGCCTGACTC
CGCCTACCCCTACGGCTCCAAGCAGTCGTCTGGCCAAAGGCGTCTCTACTCCCCCTGCCAACACTCGCATATTCAATCAC
CAGACCAACATGGCCTTGCTGAGTTACACGATGCTGGCCATGCATTCCACTGCTTTTGACCAGGTCATTCCCGTCTTCCT
CAATCATCCGCGCCAAGTGCCGGATGAGACCAACACCAAGCTTCCCTTTAAGTTTTCTGGCGGCTTTGAAATGAGCTCTG
GACATATTGGCACCATGTTTACTATCACCGCCCTCGTCTCGGCCTTGGCCCAGTTTATCGTCTTCCCCCCATTGTGCTCG
CGCTTTGGTGAACTCAGGTGCTACCGCTTTGCATGTAAGCCTCCATACACACGCCTGCTAGAATTGAGTGGTCTTTTGAA
CTGACATGGTAAAGGCATCGTGCTGCCCGTTGTCTATTTTCTCACGCCATATACCGTATTAGTCCCCAATGAACGGCTGC
GCTTTCTTGCCTTCATGTTGGTGTTTGTAGCGAAGGGCTCGCTCGGCATAGTCACATTTCCTTGCATCACTATCATCTTG
ACCAACTCGGCTCCTTCGTTGGCAGTTCTCGGCACTCTGAACGGAATTGCCACCACTGCCAGCGGCGTCGGCAGAGCTGT
CGGGCCGGCCATGGCAGGCGCCTCATTTACATGGGGCGTACGGCATGGGTACATTATTACGGGCTGGTGGTTCTTAGCAT
GCATCGCCTCCATCGGTGCTGTCACGCCTTTTTTCATGACTCAAGGAGCAGGATTTAAGCGAACTTCTGAAAATGGAGAC
GATGCAGATAGGAGAAGTCCAGAGGAGCTTGAAGAAAATATCGAAGACGGCGATGACAGCAACACCGATGCGTACGACTA
TAGCGATGCCGATTTTGAAGAGGAGCTGTTACCCGAAATTGGTGAAGATGAGGAGCAGACTGATCTCATCGTCGGCAACA
AGATGGCGAGGCCTGAAACGCCGACACCATCATTCCTACAGCGACCACAGCTTCCCCGACTACAGTCTTCTGCCGTTGCT
CAGCAGGCACAGATCCCTGAGCCTGACGAGCCGGAGATATACACTGCTGACGGCGCTTGTCTCGCGGACGTCGATATATC
TGCCCCGACCACACCGCGTACTGGCCGGTTCCGCAGCGTCAGCAACCTGTCTCGGATAGCGGCGAAGGATACGGCAAGAG
ACGAGGATGTGCCGCTGTCGCCGGTGGTGGACCGTAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62