GenePrediction:GLEAN_4895 Details

Name: GLEAN_4895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:736606..734684 (- strand)
Length: 1923
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:736606..736111 (- strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_89:735881..734936 (- strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_89:734876..734684 (- strand)
Length: 193
>GLEAN_4895 class=GenePrediction position=GCSC_89:736606..734684 (- strand)
ATGCCTTTCTCAAACAGCTCCGTGTCTGTGGTCAACGGAAATTCGAAGTTCCTTGACTTCGCCAAGGCCGAGGAGCTTCT
GAAGGAGTATGAAGCCCGTGATGGCCTCAGCATTGATGACCTGATGGACGCTAAGGCCCATGGCGGTCTCACGTACAACG
ACTTCCTGCTGCTTCCTGGCTACATCGGTTTCCCTGCCTCGGAGGTCGTCCTTGACTCTCCCGTTACCAAGCGGATCTCG
CTGAAGACGCCGTTTGTGTCTTCGCCCATGGACACTGTCACCGAGCATGAGATGGCCATCCACATGGCTCTCCAGGGCGG
TCTGGGTGTCATCCACCACAACTGCTCTCCGGACGCACAGGCCGACATGGTTCGCAAGGTCAAGCGGTACGAGAACGGCT
TCATTGTCGATCCCGTCGTCATTAGCCGCGATACTACTGTCGAGGAGGCAAAGGCCCTGAAGGAGAAGTGGGGGTTTGGT
GGCTTCCCTGTGACTGGTGAGTTGTTGAATCCTGCTGGAGTGCCCCTGTCTGGCCTTTGTGTCTTTCAAAGCGGTAGTGC
CGCTCCTCGACCGATTATGATTATCTCTCTTAAACATATAACTTTCGTTCCACCGCAAAGACTTAACGTCCTGGGGAGAA
AAATATTTATGAATCGACCTTGAACAACCACCGTGGCGAGTGATGTGTAAACCGAACAGAGCACGGCTAACTGGAGAAAA
TGCAGAAACGGGACGCTTGGGCTCCAAGCTGCTGGGCATTGTCACTAACCGTGACATCCAGTTTGAGGATGACTCCAGTC
GGTCGGTGTCTCATGTGATGGTCACCGATCTAGTCACCGCCCCGCTGGGTGTGACTCTGGTCGAGGCCAACAAGATCCTG
TCGCAGTCCAAGAAGGGCAAGCTGCCGATTGTGGACAAGGACGGCAACCTTGTGTCCATGATCTCTCGCTCTGACTTGAC
CAAGAACATCCACTTCCCGCTTGCTTCTAAGCTTCCGGACTCCAAGCAGCTCATCTGCTCTGCTGCCATTGGCACCCGGC
CCGAGGACAAGCTCCGTCTGAAGAAGCTGGTCGATGCCGGCCTGGACATTGTGATCCTGGACAGCAGCCAGGGCAACAGC
ATGTACCAGATCGAGATGATCAAGTGGATCAAGCAGGAGTTCCCTAACCTCGACGTCATTGGCGGAAACGTCGTGACCCG
GGAGCAGGCTGCGGCTCTCATTGCTGCTGGCGTGGATGGTCTACGTATTGGCATGGGCAGTGGCAGTGCTTGCATCACCC
AGGAGGTTATGGCTGTCGGCCGCCCCCAGGCTACGTCTGTCTACAGCGTCAGCTCGTTTGCTGCCCGCTTCGGTGTGCCC
TGCATTGCCGACGGTGGCATCCAGAATGTCGGCCACATTGTCAAGGGTCTGTCTCTTGGCGCATCGACCGTCATGATGGG
TGGTCTTCTTGCCGGCACCACCGAGTCTCCCGGTACCTCCTTTGTCTCCCGCGAGGGCAAGCTCGTCAAGGCCTACCGCG
GCATGGGCAGCATAGATGCGATGCAGGACAAGAAGGCCGGTGGTGGTGGCAAGGACAGCCAGAAGAGCAATGCTGGCACT
GCTCGCTACTTCTCGGAGGGCGACAGCGTGCTGGTTGCGCAGGGCGTGTCTGGTGCTGTTGCACACAGAGGGTTAGTTTT
ACCTGACAGATCATTCAGCAGGTGTGCATTAGTTTCTAACAGTCGTTCAGGTCGATTAACAAGTTTCTGCCCTACCTGGC
TGCCGGCCTGAAGCACTCGATGCAGGACTGCGGCATCCAGAGCCTCCAGAAGCTCCACGATGGTGTGGCCAACGGCACTG
TTCGCTTCGAGATTCGCACGGCTAGCGCCCAACTGGAAGGCAACGTCAACATGGAGTCGTACGAGAAGAAGCTGTATGCA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62