GenePrediction:GLEAN_4897 Details

Name: GLEAN_4897
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:724196..722486 (- strand)
Length: 1711
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:724196..723548 (- strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_89:723492..722486 (- strand)
Length: 1007
>GLEAN_4897 class=GenePrediction position=GCSC_89:724196..722486 (- strand)
ATGAACTGCGATATCTGCGGCCGTCACTACCATGCCCAGCGTCTGCCTTTTCTCTGTCCTATCGATGCCCGAAACCAGTT
GTATGAGCACCGGCTGGCGCATGCGGCTGCGCTGATCCAGAATGAGCAGCTGGAGCAGCAGGTGAATGGCGAGCTGCTTC
TGTCGTCGGCCGCGGACGCAGAGGATGAGAAGCCGCCGGCGAAGAGACAGCAGCAGCTGAAGCGGCAGCCGAAGCAGCGC
GATGCGCTTTCGGCCAAGAGCCGGCTCGACGCCTGGGAATGCGAGCGGCAGGAAATCCTCGAGCGCACCAACGACGTGGT
GCAGCGCGCTGAGAAGCTGCGTGCCGACCTCGAGGCCGCCCGCAGCGAGCTCGAGCGCCGCAAAGACACCAACCGGCGGC
GGCGCTCCGATCTTGCGGCAGCTTCCAACGGCACGGCCACCCGGCGGTCGCGCATGCAGGACGAAGTCGAGCGCTCAATC
TCCATGACCCGGTTCAAGTGGAACCGTAGCTATGACGCTATGGCTGCTACCCGCGGCTTCCTATGCATGGAGGCTGCCAA
GCTATACGGCCTTCGCCGGCTGAAGCGAGGCAGCACAGTTCACTACGAGATTGGCGGCCGCGAGATTGTCAATCCCTACT
CTATGAGCAGTACGCATTCTTCTTTAGCTTTTATCCTTGCTCTTACTGACCATCTGCCGTGCAGACTTGCAGCCAGAAGT
GATCTCCACGAGCCTCGGCCACGTCACACATATTCTGATGCTAGCTTGCCATTACCTGTCTATCCGGCTGCCGGCCGAAG
TCACGCTCCCTCATCGGGACTATCCTCGACCGACCATCTTTTCTCTCTCCTCATCATACTCACACGGTGACGTGCCGTTT
CCCGGCACCGCCACCTTTCAGCCGTCACACGCCGCCGGCCGAGACCACGAGCCGTTCCAGCGAGTGCCGCGTGCGCGGCC
GCTCTACATTGACAAGCAGCTGCCTGTCCTCTCCAAAGAGGACAGTTGGTCACACACCATGTTTCTGGAGGGCGTCGCCC
TGCTCGCATACGATATTGCGTGGGCCTGTGGATCCCAGGGCGTGCCCATTGGCGAAAGGTCGTCGTTTGACGACGTCTTC
AATATCGGCCGCAACCTGTACAATCTGCTAATTGGCAGCCAGCTGCTCAACAACCCGGCCGGCCGCATCTTTTCCACGTC
TTCCACGCCGGCGTCTCCTGGGGGGACTATGCGCCAGACCGATGGCGGCGTTGGAGGCGGCCGAGAAATAAACGAGTTTG
GTAAGGCTGCCACAATGATGGGACGTTACTCTCACGGAACGGCTCACACTTTCCTTGGTGACGACGTCATTCGGGCCTTC
AAGCTCCCGAGTCCAAACCGTCTCGCCGACCGCCTGAAGACCAGGCTGAGCAGCGAGAGTACGCTTCCTGACTGGGAAGT
TCTCGACGACGAGTCTTGGGCTGCAGACGATCACAACAACATGGAGGACGGTGTCTTGTCCAAGGGCGGTCAGCAAAACG
GTGGCAGCCGTGCTCCCGACAGGAGGCTATTTGGCGTGGAGAGCGTGGCGTCGGTAATTACAGATCTCGAGGACACCCTG
GCGCTGGCCGAAATGGACGTGAGCCCTAGGAGCCGACGGCCGGAGAAGGTCAGGTCTGCCGGGACGAGTGGGTGGACGAA
GTTGCGAACTCGCTCAGGTTCCACCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62