GenePrediction:GLEAN_4898 Details

Name: GLEAN_4898
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:714439..711853 (- strand)
Length: 2587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:714439..714005 (- strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_89:713933..712940 (- strand)
Length: 994
Type: CDS
Source: GLEAN
Position: GCSC_89:712676..712311 (- strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_89:712256..711853 (- strand)
Length: 404
>GLEAN_4898 class=GenePrediction position=GCSC_89:714439..711853 (- strand)
ATGAACGCATCGGCAGCTGCAGAATCTGTTGCGCTGACATGCGAGGTCATCGTGCCGGATCCTGCGGCTTCGCCCCAAGC
GACCGTCTCGCGCTGGTCGGACTGCGGCCTGAGTGCGCCACCAGCCCTGGTGGTCGTCCCCGAGTCTGAGAAAGACATTG
TCGACGCTATTAGCTATGCGCGGGCGAAGGGTCTGTGTCTCCTGGCGGCCGGCGGCGGAAACGGCACATTTGCGCCTGTC
GGCGCACAAACGCTGTATCTGGACCTAAAGCGGTTTAACACCGTCAGCCTGGACGCGGCAGCGTCATCTGTAACTGTCGG
CGGTGGCGCCCGAACCGGCCAGGTCTTGAAGGCCTGTACCGACGCCGGCTTCTACACCAGCTGGCCGCACAGCGATACCG
TCGGCTATACCGGCTTTGTTCTAGGCGGTGGCAACGTAAGATGGAACGGCAACGCGGCGGCCGACAGTGGTGACGAGCAA
GAGCGACGTTGACACTGGACATGCAGGGTATCGCGGTCGGCCTCCACGGCATGGCCATCGACAGCGTCCTATCCTTCCGC
GTCGTCACGGCCACAGGACAGACCGTAGACATCAGCGCGACGTCCGAGGGCGACGAGCTGGAGCTCTTCCACGCCCTCTG
CGGCACCGGCCACGGCCTTGGCGTCGTCGTGTCGGTCACGCTCCGGGTCTATCCGATATCCGAACTCGGCCTGACAGACG
GGTCGATCTGGAACCGTCGTCTGGTCTTCACGACAGCAAGCCTAGACGTTGCTGCTGCCACCTTCTCCCGCCTGCAGAAC
CCGGCGCCGACGCTGAGTCCGGTCCTGCTGTTTGTCCGTGGCGGCGGTCCGGCCGCTGCGCCGATGATCATGTTGAGCGC
CTCGTACATGGGCCCAGCGGACGATGGCCTGACCGCTGCGGCCCCCCTGTTCGACGAGGCTGTGATGGCGCAGGCCGTCA
AGGCCGACACCGGCGCGACGCCGTTTGCGCATATGAACCAGGGCTTCGCCAAGTTTGATCGCCAGGGCGGCTACAAAGAG
ATCGCATCGACGCGACTGCGTGCAATCAGCCCCGCGGCCGTGGTGGCCGTCTTTCAGCGCTGGCTCGCCTTCACCGATGC
ACACGCAGACGCGCGGCAGACGGCCGTCATCTTTGGAAGCTGCAGCACGGCGGCACAGCTGCAGCTCGAGCGTGAGGGCC
GTGGTCGAACGCGCTCCTTTGATAATCGCAACCGGGCCGTCAACGCTATGGCCATGACCTCGTATACGGAGCCGGCAACG
GGCGCCGCCTGCGAGGCCTTTATCCGGGACTTCAAGGCCATCTGCCGACAGGACCAACCGGCCACAGATGCGCCCCGGAC
GATCGTCAACAACATGCGGCAGAATACCGCGCTCGAGGAGATGCAGAGCCGGGAACGGATCGCCGAGCTGAAGCAGATCA
AGAAGCTTTGGGACGGCGAGGGTATTTTCTGGTGTCCGTACAACGAGACGGGCTTGGAGGGTACCTCTACATAGTATGAT
AGTTTTACAGTATTTCCTGAATATAACGTGGCGTGGATCTAGCGAAACTTGTGAGAATTACAGCCTCGCAGAAAACGAAG
CCTTGTTCCTAGGCGGGTGTGTAATGGATCACGTGCTTGTAGGACAACGAGAAGGCCTGTTGCAGACTAGTCTGTTTTCG
ACTTGACCGCTGCTTTTTCTTCCTTGGCTGCCGGCCAATCGAGTTCCCCGCATCACCGAATGTCGGAAACCGGCCCAACT
TAGCCGACTCTCTCCGCCAGCAGCTCCAGCAGCTCCTCTACCAGACTCATCCTCCCCGCCGGCCGTCTAGCTCTTGCATT
ACGACAGCTGCGACTATGGGATTCAAGCGAACGTCGATCGTGAGCGGTCTGCTCGGCACCTCGACGGTAGCGGCCTATTT
GGCGTCCAGAAACCCAGTGATCTCGCCGCTGGCGCCGTCGGATCCAATCTTCAGCTCGAGCGTGTACAAGAGAACAAATC
CGGCGAGGAACCCGGCGACGCAGGATGTGTGTATCAAGCGTCTGCCCATGTCGAGCATCCGCCCGGAGCTGTTGCAGAAG
GATGGCCCGCTCGTGCTGGAGTTCTGCCGGGGGCTATGGAGTGGATATGGTGATTTCCCTCTTCCTTTCTGTCTTTTCTT
TCGCCTTCCGCTAACACCCTCAGGCTACGCCATCCAGCGCAAGTTTCTCGACAGCAAGTACCGCGGCCCCGAAACAGCCA
GCCAGCTGTGGGACACGGAGGAGCTAGCGGCCAGCACATACGACAAGGGCACGGTGATCACGGACCACTTTGAGGTGGTG
GAGAAGACGCCGACGTCGATCACGGTGCGCTGCGGCGACTCGCCACGCAACAAGGGCCCGCGCGCGTCGGACGGTCTCTT
TGTGATCAGCGCGACGATGGACAAGCCACGCGAGGAGGTCGAGCTGCGGCTCAAGAGCGTGCTGTTCCAGAGCGAAGGCA
ACGTGGTGGGCACCAAGGGTCCAATGTCGCCGTGGATCGAGGAGCTGCACCAGTGGTACGCAAGGCTCTGGTCCGAGACG
GCATCGTGGAAGCTGCGCAAGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62