GenePrediction:GLEAN_4899 Details

Name: GLEAN_4899
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:710387..709421 (- strand)
Length: 967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:710387..710330 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_89:710256..710103 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_89:710036..709421 (- strand)
Length: 616
>GLEAN_4899 class=GenePrediction position=GCSC_89:710387..709421 (- strand)
ATGGCACCTTATCGTCCCTACGAGTCCAAACTGGGCATTGTCACCGGGGGATCTCGAGGTCCGTTCAGCCTCTCCCAGTT
CCGGTGCTGCGGTGTGCGGAACGATTATTGACGGGCGCGTCCCTGCTGCAGGCATCGGAGAGGCCGTGGTTCGGCGGCTG
GCCGCCAAGGGCTGCAATGTGCTGGTGGTCTACACGTCGGACGCATCGACCGGCCCGACAGATGCGCTGATCGCTGAGCT
GACGGCTGCGCATGCCGTCCACATGGCCGCCGTGCAGGCTGACCTGTAACAGCCGGCGGCTGTGTGCGGCCGCATCGTGG
AGGCAGCGCAGACACTCTTCGCGTCGTACAGCCAGAAGCCGTTTTGTGTCGACATCCTGATCAACAACGCCGGCGTCGCG
TCCAACGAGCGGCTCGGCACCATCGCCGCCGCCGAGTTCGAGCGTGTCTATGCCGTCAACGTGCTGGCGCCGCTGCTGCT
GACCCAGGCCGTGGCGCCACACCTGCCACATGACCGGTCCGGCCGCATCGTGTCCGTCTCGAGCGTCTCGTCCTCCATTG
GCTACCAGAGCCAGTCGGTCTACGCCGGCGGCAAGGCCGCGCTCGAGGCCATGACGCGCGTCTGGAGCCGCGAGCTGGCT
GAGCGTACTACCGTCAACGCCGTCAATCCGGGCCCGGCCTGGAGTGACATGTACGAGCGCGTCGGGCCCGCCTTCTGGGA
CATCAACCAGCCATACGTCGACGCCGCCCCGCTGGCCGCCTACCACGGCCAGCCCGCCGTGCTCGCCATGGCTGGCTCTG
ACGCTCACCGCTTTGATGCCCTCGTGCGCACGGCCATGAACGGCCGCCGCCCCGGCTTCACCGCCGAGATCGCCGGTACC
ATCGACATGCTCTGCTCCGAAGAGTCCGGCTGGACCACCGGCAGCGTTATCTGTGCCAACGGCGGCATGAAAATGTCCAT
TGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62