GenePrediction:GLEAN_48 Details

Name: GLEAN_48
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:340829..342990 (+ strand)
Length: 2162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:340829..341099 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_179:341295..341992 (+ strand)
Length: 698
Type: CDS
Source: GLEAN
Position: GCSC_179:342057..342755 (+ strand)
Length: 699
Type: CDS
Source: GLEAN
Position: GCSC_179:342814..342990 (+ strand)
Length: 177
>GLEAN_48 class=GenePrediction position=GCSC_179:340829..342990 (+ strand)
ATGGGGGCAACAACTCGTCCTCTCCTCGCCTCGGCGCTGCTTGCTGGCGCCGTCATTCTAGCACTTGCGCCGGCTGTCGT
GCTTGCGCATGGCGACGACGAGGCTATGAACATGGAAGACGAAGATGGGATGGGCGGAAATATGACGGCTCTGCCCTACG
GCAATGCCACCGTCTACCTGCCGTCATACTTCAGTCACACTGAGCACCGTACCGAGATCGTCATCCACATTGTGCTCATG
ACCCTTGGTTGGGTCTTTGCACTGCCTGTCGGTAAGAAAGTCCCATTCTCCAAGCAGCTCCTGAGAGCTTCTAGCAGGCT
GTCCCGAGCTTCGCGCTAGCTCCAGGAAGCTTCGGCAAGCTCTGGCAAGCTCTTACAAGCTTCGTCGGAACGCGCGGAAC
CCTCAAGCAAGCCCCTGCAAGCTTCAAATCATCGTTAGGGAACAATTAAAGCTAACCCGGCAACAGCGGTCATGCTGTCT
CTTGCGCGGTCTCGCTACACTCTGGCGGCCCAGCTTGTCTTCCTGACTGCCAATGCAGGCGGCATCCTCTTCTCGACCAC
ATATAACGCCAATACGCCGGATCTCTACCCAAACAACGCCCACCACAAGGTTGGCTGGATCGTCACCTGGGTAGTGTCTG
CACAGGTTGTCATCGGCCTGCTGGCCCGTGTGGCCGGCACCTTCAAGGCCACCGGCCGCAGCGACAGTAATAGCGAAATG
GACGAGATCCACAGCGGCGAGCGCTGTGCCTTCATCCCCGTCTCGACTGAGGCCATGGCCCGCCACCACAGTCAGCATGT
CTCCGACTACCGCATGTCCAATGACAGCGGCCAAGGCACCGAGCCAAAGACGGAGTCGCTGCGCAGCAACTCGCTGTCGA
CGCTCGACAGTGCTCTCGACCGCCAGAGCTTCGAAGGCCCCAGCGAAGACCGCCGGCTTCACCACTTTGACGACGACGAT
AATGACGACCTGGAGGCCCGCCTGCCCTCATCCACGCCGAACCGCAGCGGCCGCGTGTACGCTCTGGCCGGTAAGGTGGC
CGACAAGATCTCTTCGCGGGCCTGGCGCTTCCTCATGCTGGGCTACTCCGCTGTCGACCGCATCATCCTGGTTCTGGGCT
TCATCACCTATGCGCTGGGCATTATCGCCTACGGGCGCTTCTTTGTAAGTGGAAACGGAGCCTGGAGAGAGGAACCTGGC
TCAATTCGGTCGACTAACTGCGCTGCAGGAAGGCCGCCTCGTCTTCAACGGCCTGGCACACTGGATCAAGGGCGGCGTGT
TCTTCTGGCTGGGCATCGTCACTCTTGGCCGCTGGGCTGGCTGCTTCGGTGAGCTGGGCTGGGCTTGGAACGTGCGGCCA
AAGACGTTGTCGCAGAAGTGGCGACCGTCTGCCGAGTTTACCGAGAGCTTCCTGATCTTCTTCTACGGCGCCACCAACAT
CTTTATGGAGCATCTGGGTAACGACGACGGCAAGTGGCATGCAAACGACCTGGAGCACTTTTCTATCACCGTCCTATTCC
TCGGCGGCGGCCTCTGTGGCATGTTGATCGAGTCCAGGTACATTCGTGACCTGCTGAACACAACGGTCAGCGAGGCCGCT
CATGAGTACCCAGAACACACCTATCACGAGGAGGAGCGCGAGGCCCTGCGCCCACCGCCTCAATACGAGTTCTCCATCAA
CCCTCTTCCCACGCTCGTCATCATGCTGCTCGGCTCCATGATGAGCTCGCACACCCAGGCAACCATGATTTCCAGCATGA
TTCACCGGCAATGGGGCAACCTGCTGTCTACTGCCGCTGTTGCCCGCGGTCTCACTTACGTAATCATCTACCTGCGTCCG
CCCAAGTCGATTCTTCCGTCGCGGCCACCGACCGAGCTTATTGCCTCCTTCGGACTGATCGCGGGTGGACTGGTGTTTAT
GGGGAGCGTGAGTAACCCTGATATACTGTCGATCTCGTCTAGAACCGGGAGGCTGACATCAACAGAGTGCTGATACGGTC
AACGGGATGATCCACTACAAACTCAACGCGATGTTTGTCTTCACGGTGACGATGGGCCTGGTCTCCATGCTGATGGCCTG
GGTCCTCGTGGTGATTGCCCTCAAGGGTTGGGCGGTCCGCAAAGAGCTGGGCCGGCCGGCCGGCTCCTACCAGCTCTCCT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62