GenePrediction:GLEAN_4900 Details

Name: GLEAN_4900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:708962..705189 (- strand)
Length: 3774
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:708962..705189 (- strand)
Length: 3774
>GLEAN_4900 class=GenePrediction position=GCSC_89:708962..705189 (- strand)
ATGGGCTGGCGGAACGATGATCAACGTACCGGTGCCGCTCCGGACAAGATGGAGGACAGGCCAACTGCCAACGAATCCGG
CCGAGTTGTCACATTGATGTCCGAAACAAGCTCCAAGAACATACATCCGACCTCCTCCACCGCCCTCCAACCCCTGACTG
CCTCGCTGTCTTCGTCCCCGTCTTTGTCTCCGTCTCTGTCCTCGCCATCTCCTCTACCTTCCCCGATCCCACCCACTTCG
CCAATCTCCCTACCCGCCAGCAACAGCAGCAGCAACAGCAGCAGCAGCAAGCGTGCACCGACACCCAGCCAAGACGACTC
CGATACCAGCAGCGGCGTCGACAACGACAACGACCTGTCCACCAGGCTCTTCCGATGGCTGTCCACCGCGACCCCCGACG
CTCTCGGTGCCGTCGGTGTCGGCCTGGCTGCGACGACGTACTTTGTCCTCGGACGTGTGGGCCTGGTCCTGATGGGAGCC
TTTGGTGGTGTCGTCCTCTTCGTCGCGTGGGAAGCCCGCAATCCGATCGTCTCCCGGGTCGTCCAGGGCGAGACGGGGAC
GGATGCGCTCGCCCGCATCATCGAGTATCATTCACGTGACCTCCACCAGCAGCGCAATGAGAGTGCTGCCGAGACGACGT
CCGATCCGGTCGCCGATCCGGTAGCAGCCATGGCCCTGGCAGCCCCAGACGAACAGGCCCTCAGCCACGCTTTCGACAGC
TTCCGCCCCGAGACCCGGCTCGCCATGAGCGGCCTGGTCGACTCCATCGTCCTCGAGTACATCAAGTCGTGGTACGAGCC
CATCGCGCCGGCCGATCAGTCGTTTGCGCTGTCCTGTCGTCGCGTGCTCACCGCGTTCCTCGTCACGGTCTCCAACCATC
TGAGCCGGAAGCGGCCGGCCGACGCCTTCCTCGACTTCCTCACCAACTCGTCCTCAATCATCATTGTCTTCTTCTCCGAG
CTTGCCTCGGCCTTTGCCGAGATGCCGTCGCAGCAACAGCAGGAAGACGGATCGGCTTCCTCGATCATGGCGGCCGATGC
CATCCACAACTATCTGGCGTCGAACCCGGACTCCCATCTGGCAAACCTGCTGGACAAGGGCCAGCAGACGAGCAAGCTGC
GCATGGTCTCGGACGACCTCCTAGGCTTTCTCGACCGACAGACGTACGAGTTTGCGCCGGCACACACGTTTCTGCGCGAG
GTCCTAGCCAGTGCCGTGCTCGATGCGACGCTGCAGACATGCTCGAAGCCCGAGTGGATCAACGGCTGGATCGTGTATCT
GCTCGAGGCGGGCGAGCCCGACTTCAGCCAGGCGATCGACGTGGGCATGCAGACGCGCACAGACAGCTCTGGTTCGGGCG
CCGCGACCAGCAAGTCGGCCCTGTACGTCGACCTCGACGGCAACGTAGGCAGCATCGCGCTGACCAAGGGACACCGGAAG
GAGCCGATGACGCACAAGAAGCAGCTCAGCCGAGCCGACGAGGAGATGGAAGAGGCCATTGAGGAGATGAAGCGCATGAA
CCAGATGATTGCCGACGAGGATGCGCGGCGTAAAGACAAGGGTGATGAGGCAACGACTGATGAGGCCGGCGATAGGGCCG
GACAGTCATCGCCGAGCACATCGTATCACACGTCGTCCAAGCCATCGCTGAGCCTCTCGGGAGACGAGTCTGCGCAGGTG
GCCGATGGCCTGTCGACACCGCTGACGCCACGGTCGTCGGCTGGCGATTCGCCCAACCAGTCTTTGTTTTCCAAGACGGA
TGCCAAGACGGATGCCAAGACGGATGTCAAGATAGATAGGCAGCTCACCCACTTTGATATGCTCGTTCCTCCAGCACGCG
ATGAGGAGGAGACGAGCGACACGGAGGGCCAGGGCCGCAAGCAGAAGACACCAGCTCCGCCGCTGACTCTGCACAACGCG
ACAATAACGATCCACGACGAGCCGGCGCCGGACAAGGGTCGTCTGAAGAGCAAGCCGGCATGGGACTTTCTGGTGCAGAT
CGAGCCGGCCAACTCGCACTACCCGGGATGGATGATTGTGCGCAAGTACGGCGACTTTGAGAAGCTGCACGAGGTGATGC
GTCGAATTGCAGCGGTCTCGGGAGCGACAGCGTTCACAGAGCAGCACAACGCGCTGCCGAGCTGGAAGATGCACACGCGA
GCGTCGCTGCGAGGCGAGCTGGAGCGGTATGTGCGGGACGCCTGCTGGTTCCAGCCGCTGGCCGAGAGCGAGGGCCTGAA
GCGCTTCCTGGAGAAGGACGTCAACAACATGCCAGCGAGCAAGACGGGGTTGCAGGCGTTTGAGAGCATGGGCAAGAACA
TGCTGGACGCGCTGACGAATGCGCCCAAGGGCATGGCCGAGAGCAGCAAGGTGATGGTGGGCGGCATAAGTGGAGCGCTG
GGCAACATTGGCAGCATCGCGTTGGGAGGCGCGCTGCAGAAGAGGCAGAGCAGCACGCCGTCGCTGACGGGCGGAGCATC
TGTCCAGACGAGCAGCAACGAGACGACGAACGCAGCCGACAGCAGCAGCAGCACAAGCAGCAGCACCATTCCAGCGACGA
CACCAACGAGCTCAGTACTGCAAGACGTGACAGCATACACGAACCGGCTGTCGATCTCGACGCCGCCACGACGGTCACGC
GACAGCATGGACAGCCAGCGATCGTCGGTGTCGACGCAGCCAAGCCGGCTGGTGCCACTGGAGAAGCGCCACAGCTCCCA
GGCCAGTATTGGGGCTGACGGCGACTCGACGCGCGGCCGTTCTGACATCTGGAGCAGCGAGCAGCCGGCGCCGCCACCAG
CCAGCAATCGCGGAAGCCGGGCGTCGTCGCTGATCGGCCGGCCGGCCCGGTCGCCGTCGGCGACGAGTCTGGGCGGTGGC
CGACGTCTGTCGTTTCTGCCGACAGCCGTGACCGATGCTGCGGCTGCTTTTGCTGCCGGTGCGGCTGCAGCGGCCGGTGC
TGCTAGCGAAGACCTCTTTGGGACACTGTCGCCAGTGAGCTCGCCGGCGCGTCAGGGTCGGTCTATAGCAGCCGAGGGAC
GACCCCAGACGCAGGTCCAGACGCTCTCGCAGACGATCGCCCAGACACTCTCGCAGACGCAGACGCAGACGCAGACGCAG
ACACAGACGCAGACACAGACGCAGCCACAGATGCCGACAGCACAGACGATGCCGAACACGCCCAACACACCCAACACGCC
CAATCTGCCCAGTCTGCCCAACACGCCGCCGCCGTGGAAGCCGGCACCCCCGCCGACATCCTATACGAAGCAGTATGCGG
GCATTAGCGAGAGCGAGACGCGGGTGGCGGTGGAGCTGCTGTTTGCGGTGATCAACGAGCTGTACACGCTGTCGTCGGCC
TGGAACATCCGGCGCACGCTCCTGGCGGCAGCCAAGTCGTTTCTGCTGCGGCCCGGCAACCCGTCACTGACATCCATTCA
GGCACTGCTGCAGGCATCAGTGCTCGACAGCACGACGTCTGATGGCGGCCTGGCGGCCCAGCTGCAGCGCCTGCGGGCGG
CCGCCGTCCCAACCGAGGCCGACCGTGCTGCTGCGCCACCGCCGCTGACGGCCGACGACCGCGAGAAGCTGCGCCGCAAG
GCCCGCCGACTGCTGATCCAGAGTGGCGTGCCGGCGGCCCTGATGGGCGTCATGGGCCAGACAGCCACGGCCGACGCCCT
CGGCCGGGTCTTTGACTGCCTGCAGATCGAGGAGGTCGCGCGCGGCCTGCTATTTGGGATCCTGCTGCAGGCGGCACGCA
TCGTGACGCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62