GenePrediction:GLEAN_4903 Details

Name: GLEAN_4903
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:694591..693413 (- strand)
Length: 1179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:694591..694417 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_89:694334..694289 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_89:694226..693413 (- strand)
Length: 814
>GLEAN_4903 class=GenePrediction position=GCSC_89:694591..693413 (- strand)
ATGGTCCGCAAGCTTCCATGGGACAGGAGACAAGAACGTTCACGAAATTCTGTGCCGCGGCACTCTTCGTCGTCGCGTCC
GGCGCCGATGGCACATGACGATGACAGTCCCCAGGCGAGGGTCAGAGAACCGTCAGTATCGAGAGATTCACGGGCGAGTG
CCGTGGCGCGCAAATGTGAGTTGCCCTGCACTTTGCGACATGTGATTTTACATTTTATGGTGTTTGGGGCTTTCTTCTCT
GACCGGACTCCCTACAGTCCGTTCGCCGTCTACATCTCCACCACCGGCGCCTCCTTCAGAGACGTAAGTTTTTGCTTCGC
AGTAGAGACTTGTTGGCTGCTACAAGCTGAAACCTCTGGCCCCAGCTTCATGATCGCCGGCATGGATCATGACGACCAGT
ACCGCATGGTGGAGGACGAGCTTCTTTCCGTGGCCCACGAATTCACAGCCCACCTGCACGCGGCCGAGTACCATCGGCTG
AAAACGACGGCTAAGAGTCTGGGCGCCGAGGCCATACGCAACATTTCGCGGCCCGTTACGGACGGCCCGACACCATCGGT
GCGGCGACAGCAGGAGGCAGACAGGCGCGCCGAGAAGCTGCAGCGCGGTCTGCAGTGGGCGTTTGGCAGCGGCGGTGGCG
AGGACGAGGACGCGGACGTGCACGAGGATGCGCCGTGGAAGGGCACGGCGCTGCAGAACATCATGGAGGGCACCGGGCGG
AAGGTGGCGCTCGTGCCGCTTCTGGCGGCTTCATCACGACGGCCAGTTGAGGCGAAACGTCTCGACGTAGAGACGGAGGA
TGATGAGGACGACGAGGACGATCTGGACGGACCGTCCATCCTGAAAGAGTCTGCTTTAAGACGGGGTCAGGTGGCCGCTG
TCGACACTATGGACAGGTTGGCCTTTTCTTTTGATTCAGCCACGTCGACGACCGCAAACGAGAGCAGGCCAGACGCAGGT
CGAGACAACAGAGACACGGACAGCAGCGACGCATCAGACAGCCTGGACATGAGCGGCTTGCTGCAGAAGATACGCCAGCG
CCGTCAGCGAGAAAAGGCACAGCGACAGCAGCAAAATCAGCAGAGATGGAGACCGGGGCAGGAGAGAAACACGGACATGG
CGAGCGCAGCAGTCAAGAAAGAGACAGAGGATGTGGACCTGTTCAGCTGCAAAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62