GenePrediction:GLEAN_490 Details

Name: GLEAN_490
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:139388..140131 (+ strand)
Length: 744
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:139388..139462 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_97:139526..139578 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_97:139669..140131 (+ strand)
Length: 463
>GLEAN_490 class=GenePrediction position=GCSC_97:139388..140131 (+ strand)
ATGTCTGGCCAAACTGCTCAGGAGCAGGTCAATTTTCTTCTTGCCTGCATCAAGCACAGCCAGTCAGGCGGCAAGGTATG
CAATCAATTCGACAGTCTTTGAACACCATATTTTTCGCTCACCCGTTACTCATTTTAGGTCGATTTTGAAGCTGTTGCCA
CAGAGCTGAAAATTGCAAGCAAAGCTGCAGCGTATGTCGCCGGATTTGTTTTTTCTGTGTTTTCCTCGACAACAAAGAAG
TAATCTGCAACTGACAGGTGTCCTTTTTTGTCTCGCTGTAGTGCCAAGAGATATGAACGCCTCAAGAAGCGTGCCCTCTG
CACTGATCTTTCGGCTTCTGGGCCAGCTGGTGATCTCGATGGGAACGGTAGTCCGTTCACTACACCTCAAAAGTCTCGCA
CGAAGTCTGCTCCTGCCACGCCAGGCTCAGCCAAACGCAAGCGGAATGGACAAAGCAACAACACCGATGAAGAGAAGCAG
GATTCTGAGGTGAATGTTAAAACCCCTCGTGGTAAAGCCAAAGCAGCAAACCCTACTACTCCCCGCGTGAAGCGTCAACA
GGCTCAAAAGGCTGCCGAAGCCATCAAAAAGGAGGCCGAAGCCGAAGACGCAGAGGACATTGCAGAACGCGATGAGCAGC
TTGCATATGAAAATTATGAATCGGATGTGGACGAGATTCGTGACGATGTCGTTGCAATCAAGTCGGAGTCCCGAAATATT
GTCGTGGATACTGATGGCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62