GenePrediction:GLEAN_491 Details

Name: GLEAN_491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:142285..148376 (+ strand)
Length: 6092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:142285..142684 (+ strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_97:142745..143190 (+ strand)
Length: 446
Type: CDS
Source: GLEAN
Position: GCSC_97:143607..143948 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_97:144655..144712 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_97:144928..145405 (+ strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_97:145742..145789 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:146124..146217 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:146566..146809 (+ strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_97:146866..148376 (+ strand)
Length: 1511
>GLEAN_491 class=GenePrediction position=GCSC_97:142285..148376 (+ strand)
ATGGCCAGCTCCAAGCCCACTTCGGCGAAGAAGCCAAATGGTCGGCGCCCGAAAACACCTAGTCCCTCCAAGGCGACAAG
GGTTTCCAAGACTCCCAAAGGAAAAATGTCCGAGAAAGCGGCTGCGGCGGTTCTGAGAGCCGCTTCGGCAGAGTTCGAGG
ACAGCAGCTCGGAGGATTCCATCGAGACTCCTCAGAAGTCGACGCCCTCGAAGAGAAGGAAGGGTAAGAACAGGTCTTCT
GATGCTGGCAAGGAAATATCCTCTCCCAAGACGCCTCAAAAGTCCAAGGCGTCGAGGAAGAAGCAGAAGAAGGTATGGCC
ATTCACTCATGTTCCTGCTCGCATGGACGAGCGCAGCAAGAATGGCCGCCACGAGGGCCGCAACCTCATCGTCTGGACCC
GTGAGTACAGCTGAACATTCCGAGAATTTGCGTTGTCGGCTGACTGGCCTGTCATCAAAGGCCCCCGCATGGCTGAGAAG
TTTCTTCTCCATCTCCAGTATGAGATTGCCCGTCACAAGATTGACGTGCCTTGGGATTCCATTGCTCATCGCATGCACCC
GGGGTCATCGGGCAGCGCGCTGTTGCAGTTCCTCAACCGTCTTCGTGCTGTTCTCATTGCAGAGGGACATCTTATCCCGC
CCCCTCTGCCAAAGCCAGGTTCTCGTCAGGTGGTAGACCCGACCATCCGCGGGTATGTTCGCGACGACATGGATGGGCCT
GATGCCGTCACCACACGGCCGGTGCCTTTTTCTGAGCCCATGGAAGATCGCAGGTACAATCTCCCTGATGCATTTGAGGC
CAACCAGACCAGGGCCTTCCTTGGTTCTGCCCGCAAGAGGGTCACTGTCAAGCAGGACTCTCCCGATCCGGCTGACCTTG
ATGGCGATGCAGACTACACCCCAGAGGTGCAGTCCTCTGGCCGGCGCCATCTTTCCCGGGCCGCCACGGTGTATGCTGAT
ATCAAATGTGAGGACGATGATGGCTTCATGTCTTCCTATGACATACACCACGGGAAGGGCGATGATGAGGAGGACGAAGA
CGAGGAGGTCGAAGAGGACGATGAGGAATCGGAATTGTCTGATGTCCACACCTCCGGCGACGATGATGATGATGATGCCG
ATGCCGATGCCAATGGCAATGCTGGTGGAGCCGAGGAGGCCGCTGATGATGACTCGGACGCATATGCATCTTCGGACGAC
AACGGTGGTGATTCTGGTGACAGTGCAGACAGCCAGGGGTATGCATTCACGGGCAACTCGCTGGTAAGCTGACAGACCCA
GATGAAGTTGATCCTGGCCACTGACAAAATGCCGATTTACAGATGAGTGATCCGTTTCTGTCGACGCCGGTTCACATGAG
TGCTTCATCTGGCTCTGTGGCTGGGGCCATGCTCCACCACTCCATGGCTTCTCCTGTGTCCTACATGTCGGCTGATGCCC
TTCCTTCATCTGCGCTGTACTATGGAATGGCGACGGAGGCTGCTGGTTACATCCCGCCATTTGATCACGGCATGGTGTCC
AGTCCTGCTGTTGTTGACCATTCCTTTGCAGCCCAGGGCGGGATGACCGGCTTTGAGGGGGCCTATGCAAACGATGGCAT
GGATGGGGAGTATGACCAACTGTTCACGCGTCCGGCGGACAGTTCCCGGTCTGTTTTTACCATGGTGAGTCGAGAGTTAT
TCAAGGCGAGGCGAGAAAGAATTGTGGCTGACCATGCAGTGAGGGAAAGGACAAACGGCTCTGAAACAACGAAAGGCTCT
CTTGATGCATTGAAAGGAGATGTTCGCATTTGATCTCAACACCTTTTCAAATTTCACTCTTCCTTATATTTTGTCATTTT
AATTTCTCCGTTTTACTTTGCATTTCTTTCCTACAATTTCCTTTTCCTTTTCCTTTTTCGATTTATTTTGATATTTTATT
TCGCTCCCATCTCTGTCATTTTCTCCTTTCACGGGCTTCTCGCTTAGTTTCACAAAAGTTCCTACGCGTCCTTTGCAAAG
CCCTCACGTTAGAACAGGCAAGACAAGAACGGGTGGTTGAACGGAACAAGTGCTCACTGATTGACGAGTGTCAATGGCCC
TGACGGTGGAACAGCGGTTTGCAATCTCGGATTTGTTCGCTCTAGTGAGCTCGACAACAAGTGTTTGTTTTATTTCGGGT
TTCAAATGGCGAGGTTGACAGATGCAGGAGGACATTGACTGTATAATGTTGCTTCCTAGACTATGCACAAGTATAGATAA
TGAATCGGGCTCTCGTCTTAAACACATTCGTGCACCTGTGGCTTGCTTATGCAGTCCGGAGACAGTCCAAGTCGAGGATA
GAAAAGTACTCATCTGTACGCATTCTCCAGTGGCTGGATGACAAAACTAGGGCGAAGGGGCAGGAGCGACCTACTGGCGA
CAGGCCATAGTTTTCCCGGGTCTAGAAAGTTCTGTCGTCAAGTTTCTTGATAGTACAAGAACAGATATTGCGTTCGTGTG
ATCGGAGGCGATCCTATTCGAGAAGCCGCGAGAAAGAGACGTGCATTCTTGGTCGTCTTATATAATCGGTCACAAGCAGA
CTGACGACGGAGCAGAGTTCCGGCTCGCGGCAGGGGTCAGCCATGAAGCCTCCGTGTTCTCGTCGTTCCCGCTATGCATG
CAGCCGAAGCTCCGGCGGACCAGCCGGGCAAAGGCAGCGGTGGTGCCGATGAGGGACTTTGCGCCCTGGAGCGCGACGGT
CTGCAGCTGCAGCTGGAGAGCCAGGACGGCGGCGTGCAGGCAGCCAATCTTGGCGTAGGCGTGCATGTCATAGAAGCAGA
GCTGGGCGCTGAGACAGAGGGTGAAGCCGGGATACAAGGGGATGAGGGTGGTGTAGGTGGCGGCGGCAACAGAGTCCATC
TGCTTCCACAAGGCAGCCGAAAGGATCTCCAGCAGACCGTTCAGCTGCAGGGCCTCGTGATGGAAGGCGTCGTAGTCGAC
ACGGGCGTCGATGTGCGAAGGATGAGAAGTCGTGAGAGGAAGAAGCGTAGGAGCTTCCTCAGACGGATACTGGAACCGGC
GTCAGGCCCGGCAGCAGAGCTCAAGCGTGGACCGCTCACGCGTGCATCTGCGCTTCTGGCGGCAACAAGTCGAGGAGGCC
AGTCGAGCAAGGTTGATTGAAGTAGTCATTCGGAGGATGAAAGGAGGGGTGAAAGACTAAAAATATATTGAACAAAAAAG
GATCCATGTCTACACCAGTCCACACCATCCCACCCCGATAATGACCGCAAGTACAGTCCGAGCTGAAGCGCACATCGTGG
TTGATGCTCGGTGGGGCGACGTATTAGTGAAGTTGCAAGGCTGTGTTTGCTTGCAGCTGCTGACAAGGATGTGATTGGCA
GAAACAGATTCCCGGTCATTTTGCTCCCAACTGTTACGTCACGTGCTGCGGACAGTTGCGGACGCTAGCGGAAACAATGC
ACATCACCGTGCAGAAGAATCGTGCGGGATCGTCTGCTGTTGGCGGACAGCCATGGACATCTGGTGTAAGCCAATGGATG
GTATCTAAGAGGGGAGTCTGGGATCTGTTTGGACTTTCAAAAGGACACCCTTCTACATGGACGGTCTGAAAACACAGGTG
GAGTAGCATCAGACTGTTATCACGGACACAGGCAGCAGTTTGCAACTTTGAAGTTCCAGGTGTCGTGACCCTTTCTTGTT
TTTTGCTTCTTTCTTGTTCTTTCTTGCCTCTTTCTTGTCTTTTTCTTGTCTCTTTTTCTTTTCTTTCCTTCTCCTTCTCC
TTTTCCTCCTTCTCCAATGACAACCAGACCATCTAACTTACCTACTAGCTGCTGACTCACCACCTGCTTCCTGCTACAGT
GTCGTATCATCAACTTCTCCTCGACCGGCCACATCCGGCGTCGTCAACGATGGCCTGCTCGTCGACGCCAATCAGTCTTG
GCCGTCACCAGGGGTGCGTATACGATTACATAAGCAATACATTTTAGCGTTACCCCTCCTCCCCGTAGAAGTGCATAGAA
TGTATGGTCGTTTGGAGAAGATGCTGGTGCCGGAGCAGCTAGTCCCAGTGAAGCTTAGCTGCTCCGAGACGTCCAATTAT
TATGCCCGAGGTGCTATTTTTTTTCTTCTTGATGAGCAGCTTCTCCAGAATTTTGTGCTCCTTCTCTCTTCCGCCTCTTC
CACTTCTGCGTCGTCCCCGTCTGCAAAGTTTGCGTGCGTTGACTGTCTGCCTCTGTCTATCGACACTGCTGTCCCTGTCG
CTTCACATCTCCGTCCCGTCCTCCTCCCCCACACAATGCAGAGAGCCCTGACTTCCCGGGCAAGAGCCTCGGCTCTGTCG
AGTGCGGCCAGCCTCCGGCCGTCGACCAGCCTGTCGATGCAGCAGCGCCGGTTTGCCCACAAGGAGCTCAAGTTCGGCGT
CGAGGCCCGCGCGGCCCTGCTGGCCGGTGTCGAGACGCTGGCCAAGGCCGTAGCCACGACGCTCGGCCCCAAGGGCCGCA
ACGTCCTGATCGAGTCCAGCTTTGGCTCACCGAAGATTACCAAGGGTGCGTATGCTGCTGCGAATGGCGTGTGGAGTACA
GAACACGTGCTGACTGTGCAGACGGCGTGACGGTGGCCCGGAGCATCACGCTCAAGGACAAGTTTGAGAATCTCGGCGCA
CGGCTGATTCAAGACGTCGCCTCCAAGACCAACGAGGTAGCCGGTGACGGGACCACGACGGCGACGGTGCTCGCCCGCAG
CATCTTCTCGGAGACGGTCAAGAACGTGGCAGCCGGCTGCAACCCGATGGACCTGCGGCGCGGCATCCAGGCGGCCGTCG
AGGCGGTGGTGGAGTACCTGCAGAAGCAGAAGCGCGACATCACGACCAGTGCCGAGATTGCGCAGGTGGCAACGATCAGC
GCCAACGGCGACACGCACATTGGCGAGCTGATCGCCAGCGCGATGGAAAAGGTAGGCAAGGAGGGCGTGATCACGGTCAA
GGAGGGCAAGACGGTGGCCGACGAGCTCGAGGTGACCGAGGGCATGCGGTTTGACCGCGGCTTCGTGTCGCCGTACTTCA
TCACGGATGCCAAGTCGCAAAAGGTCGAGTTCGAGAAGCCGCTGCTGCTGCTGTCGGAGAAGAAGATTTCGGCGGTGCAG
GACATCATCCCGGCGCTGGAGATCTCGACACAGCAGCGGCGGCCGCTGGTGATCATCGCCGAGGACATTGACGGCGAGGC
GCTGGCGGTGTGCATTCTCAACAAGCTGCGCGGCCAGCTGCAGGTGGCGGCCGTCAAGGCGCCCGGCTTCGGCGACAACC
GCAAGTCGATCCTGGGCGACATTGCCATTCTCAGCAACGGCACCGTCTTCAGCGAGGAGCTGGACGTGAAGCTGGAAAAG
GCCACGGCCGACCTGCTCGGCTCGGTCGGCTCCATCACCATCACGAAGGAGGACACGATCATGCTGAACGGCGAGGGTTC
CAAGGACTCGATTGCACAGCGCTGCGAGCAGATCCGCGGCGTGATCAACGACCCGATCACGACCGACTACGAGAAGGAGA
AGCTGCAGGAGCGGCTGGCGAAGCTGTCGGGCGGCGTGGCCGTCATCAAGGTCGGTGGCAGCTCCGAGGTCGAGGTGGGC
GAGAAGAAGGACCGATTTGTGGACGCGCTCAACGCGACGCGCGCGGCCGTCGAGGAGGGCATTCTGCCGGGCGGCGGCAC
GGCCCTGATCAAGGCAGCGTCGCAGGCGCTCAACGACCTCAAGCCGGCCAACTTTGACCAGCAGCTGGGCGTGACGATTG
TGCGCAACGCCATCACGCGGCCGGCCCGGACGATTATCGAGAACGCCGGGCTCGAGGGTTCTGTTATTGTCGGCAAGCTC
ATGGACGAGTACGGCACCGACTTCAACAAGGGCTTTGACAGCGCCAAGGGCGAGTATGTCGACATGATCGCGGCCGGCAT
CCTCGACCCCTTCAAGGTCGTGCGTACCGGCCTGGCCGATGCCAGCGGCGTCGCGTCGCTGCTCGGCACCAGCGAGGTCG
CCATCGTCGACGCTCCCGAGGACAAGGGCCCGGCCATGCCCGGCGGCATGGGTGGCATGGGTGGCATGGGCGGCATGGGC
GGCATGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62