GenePrediction:GLEAN_492 Details

Name: GLEAN_492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:149808..150464 (+ strand)
Length: 657
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:149808..149810 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_97:149892..149902 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_97:149962..150145 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_97:150204..150464 (+ strand)
Length: 261
>GLEAN_492 class=GenePrediction position=GCSC_97:149808..150464 (+ strand)
ATGGTACGTCCGTGATCGCATGCTCCCAAGCCCCCCCCCTCTTCTGGTGAAGCTCCGATGTTCATCATGCTGACCGTGTT
GTAGTCTCAATCCGGGTAAGCTCTGTTCAATCGCCGGTGGCTGTCGTTGTTGGTGGGGCTAACATTGGGCCCAGAGCAAC
GGTCTCGCAGGAGTGCGTGAGCGCGTACAACGAGCTCAAGCTCAACAAGAAGTACAAGTACATTGTCTTCAAGCTGTCGG
ACGACCACAGGGAGATTGTCATTGAGGAGGCGTCGGGCGAGAAGGACTGGGAAGTCTTCCGCGAGAAGCTCGTGAACGCG
ACCACCAAGGTCCGGGGGGTTAGTTTTTGTCCCTTTTGCCTGTGCACCCGCTCTTTCCATTGTCTAACACCTCTAGGGCA
ACGTCGGCAAGGGTCCCAGATACGCTGTGTACGACTTTGAGTACAGCCTGTCTTCCGGTGAGGGTGTGCGGAACAAGCTG
ACCTTCCTCGCCTGGTCGCCCGATGATGCCCCGATCATGGCCAAAATGGTGTACGCCTCGTCCAAGGACGCGTTGAAGCG
GGCTCTGACCGGCCTCGCCGTCGAGCTCCAGGCAAACGACACGGACGACATTGAGTACGACACGGTGCTGAAAACCGTCA
GCAAGGGTCTGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62