GenePrediction:GLEAN_4930 Details

Name: GLEAN_4930
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:548984..546323 (- strand)
Length: 2662
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:548984..548675 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_89:547571..547035 (- strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_89:546981..546634 (- strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_89:546577..546422 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_89:546354..546323 (- strand)
Length: 32
>GLEAN_4930 class=GenePrediction position=GCSC_89:548984..546323 (- strand)
ATGTCGCCCCCCACGAAATTGTGTACGTGGTCGTGCATGCGTTCCATAGCGTCCTGGAACCGGAAAAAGTCGCCCGTCGT
CTTCTCGGTCGCGTTGCGCACAAAGTCTGGGCTGAGTGTGCTGTTTTGCGGGCGCTCACCTTCAAACCAGCCGGTGATGA
GCGTGAGATTCCTCCTCAGCGGATGGGGGATCGGCCACGAAAGCGAGAAGTCCCCCTTCTCGCTGGACGAGGCAAAAGCA
CCGGTGGTGACGGTACAATCCGCCTCGGGCGAGGAAGCACAGTCCCCCGTGCCGCCGAGTCCGTACTCTGGTGAGTCCTC
AAACACGGGCGAACTGAACAGATCAGCATGATCTCGCGACCAATCCCAGTAGGGTGTTGGCCCTCTGTATCCGCAAGTCT
CACGAAGGGAAGTGTCGAATAGGTATGTGAACCAGCGGTCTGTGTGAATGGTAAGCACTCTATACACGTTCTGGGGAAGG
GAAAGAACGTAACGCACGCCACGGCAAGAAGTAGGCATTCCCGTGGGCGCTGTGCTCGAGGGATGCGTGTGCGTAAGAGA
AGTCGTCGTACAGGCTCCTCTTTCCTTCGAGAACCGTCCGGTTCGTCGTGAAGGAAAGCCGTTCGTGATGTATGCTTGTC
AAGCACTACCCAGATTAGCAACGTAGGTGTTGTCTTGGGGCTTCTCGGGGAATAGGATGCACCTTGACAGCTCCCACCCA
TTTGGCTTTCTCGTCATTTGTCAACGTCCGCCATTCTTTGCGTATCTGCAGCTTTCTACACTTTATCGGGTTTCCCTCGC
CCCATGGGAGGACGGCGACGATGGCCAGCATGCACGTGAACCAGTTCGAAATCCCCATGACTATCGCTGAACCAGGAAGC
GGAAAAAAGCAGTTACGGAAGAGAGACAAGAGGACGCCGTAGATGCAGTAGTACACGAAGCCCGAATAGGCAGTTCATTA
CGGAGTGATTAGTACAAATAGGTGCCCCACCGCATTTTCGCCAACTTTCAGCTAGCCGTTATGTCTTGCTTTGCGGCAGC
TAACTCTGCTCCTTCACGATGCCCGCAATCCTATGCTTACACAAGTGGAGCCCTTGCACTTTCTGATCGTGCCATTCCCC
TCTCTCTTCTCCTATTGTGATAGCAATAGCAAGGACCAACCTTTCCACTGTTAGTACTTCTTCCCTCTCCACCCTCGTCG
CTTTTCTCTCACGTCCACCTTGAAGTCACAATTACCACGCCACAGACATGCGTTCCTCAATCTGCCTCTCCGCAGTTTCT
CTCCTCTGCATCGTCTCGGCATCTTTGTCCGATATCCCAATTCTCTCCCCAATCTCTGGGAGTACGGATGCAATACAGGT
CGCGATCAGCCCTCCACTTAATGACACTCTCATTCCTATCTCCCGAGAAACAGTCGAAGCTTCTCCCGAGGCCGCGAAGC
CCATCAAGCCTGTCCAGGCACTCGGAGGCAGGAAAGTAGAGAAAACGCGTCTCCCAAAAGGATTGGCGCACGCCATCAAC
TCCTTCGAGCAGTATCCGTACCTTGCCGAGCGCGGGCTGCAGCGGAAGTATGCTCGGTATGCCAAGCAGCTGCCTATACA
GAGGGCAGTCAGCAACAAGCTGGGCTATCCTTCCCATTTTGAGGCTGCCCGGAAGGGCATCGAGGTAAACACGCAGGTCT
TGGACCAGATCGCGCTGATTGCGCGAGAGGATTATCAAACCGGCCAGGCACTGCTGGAAGACCAAGACAATGCCGAGTTT
GGCTTAGTCAGCGGGGTGTTTGCGCACCTCTCGCGCGACTGGAGCTCACAGGGCGCCAAGGAGAGAGGGGCCGTTTTCCC
GCCTATTTTGGAGGGACTTGCGCAACATTTTGGCACAAATGCGCAAGGGAAAAAGATTCTCGTCCCTGGAAGCGGCATGG
GAAGACTGGCAAGCGATCTAGCTGATCTCGGTGCGTCTTGCATTACCTGAATTGGAATTGCAACCTCTAACACTGTCTTT
CAGGATATGATGTTACAGCTAACGAGATGGATTACGGCGCCATCTTGGCCTATCACTTGCTGGCAAACCATACTACTGAG
CTGCACCAGCATACACTGCAGCCCTTTGTAAGCGACTGGGCGCTGCAGACCAAGTCCTCCGCACGCTACGCCTCTATGAC
TGTGCCAGATCACCTGCCCAATCCGGCCGTTAAGCTCGTCGAGGGAGACTTCCTGGAGATGTTCCCGGAGGACGGAGAAT
TTGACGCTGTCGTTACACTCTTCTTCATCGACATGGCCGACAACGTGATCAACTTCCTAAGCAATATCCATCGTCTTCTC
AAGCCAGGCGGCGTATGGATCAACCTTGGACGTACGTTTCCGTGCCTTTCTCCTGTTGTGTTTACTGAACGAAACTGACA
CACAAAGCACTGAAATGGGGATCCTATGCTGCTCTTCAACTTTCCACTGAGGAAGTGCTCCAGCTGGCAGATCTGCTCGG
CTTCGATGTGGACCATACGTCCAGGAAAAACGTCGACAGCTTGTATGGTGCCCAACAGGACACATTGCTGAAGTTTACTT
ATGGTAAGTTCCGCCGTTACTTTGCTTCCCCTTTTTAAAGAGGTTCACGGTAGGTTGCTAATACAGGCAGTTACGGAATT
TTGGTCTGCGTTAAAAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62