GenePrediction:GLEAN_4931 Details

Name: GLEAN_4931
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:541263..539031 (- strand)
Length: 2233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:541263..541221 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_89:541156..539685 (- strand)
Length: 1472
Type: CDS
Source: GLEAN
Position: GCSC_89:539630..539031 (- strand)
Length: 600
>GLEAN_4931 class=GenePrediction position=GCSC_89:541263..539031 (- strand)
ATGCAGCCTCGCGTATCGCAGCGCCCTTCGCTTGCATGTCGTGGTATGTGGTTTAAGACTGTGCTGCAGTGTGTTGTACC
TTGCGACCCTGACGAGGATTTCTGCAGAATGCACGCGTAGGAAGCGGAAATGCGACAAGAAGATCCCCTGCTCGCGCTGT
GTGCGCTTGAGCCTGCAATGTGACCGCGAGGTCATATATCTCCGGCGCCACATCAGCCAGAACGGCTCGGAGATAGCCTT
CCTCACATCGTTGCGCGAGGAGCTCCAGAGCCCTAATCCCAGCAAAGTCGCAAAGGCCGTGCAGAAAATCACCGAGAGGA
TCGGCCTTCTCCACTCGGGTCAAGCCAAGGAATCGCCCAGCAGATCAGACGTCGGCTGTGACATTCTCCAGGAGCTGCCC
AGCCCAGACAAAAAGGCCCAGTCGGAGCTGTCGGATGTCCCAGACTCGCAAGCCGAACCCCAGATCGACCCTGACGGCCA
GGATTCTCTCATCGTGACAGCTCTGGAGCAGATCGCATGGGGCCGGAACTACGGCAACTGCTACCCGCATCGCCGTTGTG
CTTGTCATCACAACCGCAGCTGGTCCGAGCTGTCGTCTATCGACAGCCAGTCCTTTCAGTTTGCCCGCTCCCCGTTTGCC
GCCACGCTCAATCTTCCCCACCGCGATCTAGCGAATGTCCTCATCTCCTTCCACACGGACAATGTTGCCTGGCACCACAA
TTGCCTGCACTCGCCGACTTTTCTGCAGCAGTGCAACATCTTCTGGAACACGGGAGAATGCGACCAGCTCCAGTGGATCG
CGCTCTACTGCTCCGTCCTTGCCACGTCGCTGTTCTGCCTTCAGCATAGCCCAAAGTATCACGATAAATACGGATACGCT
CTGGGATCTGTGCCTTATTCGGCGCAAGAGCTGTTCAAAACAATGCTGGACATACTCTACGAAAGCAACTTCTTGCAGAA
CCTATCGCTGTATTCCGTACAGGCCATTGTCATCTCCACGGAAGTTGCCCACAACCTTGGCCACAGCCAGCTCAATGCGA
CCCTTTTCAGTGCAGCGATCAGGATAGCCGAGTGCCTAGGAGTGCACAAGATCGGAGATCCGAAACCGGACATTCTGGCC
TCTGACGTTCCGCTGCCTCGGGAAGAATGGTATGCCATGTTAGAGAGAGAGGTTGGGCGCCGGGTCTGGCTGCAAATGGT
CATCCAAGATCACTTTGCAATCCCGTTTACAGATTCCTACGGCATCTATCCTGCGCAGTACTCTACCAAAATACCCAGCA
ACGCCAACGACGCCAACCTCAAAGCCATGCCCGATAACATACCGACCGTCAGCACGTATACACGTGTCCTATCATCGATT
GCCGATCTCATGCCTGAGCTAGCCGACGGCATGGGCCCCTTGAAGGAGCGAAAGTCAGTACGTAGGCAGTACGAACATGT
GTTGGCAATGGACCAGAAGATGAGACATGTTGTGCGGGCCATCCCTCAGTTTCTTCTGCAGGCCAACCCGCTTCTCGAGG
CCCAGATACCTTGGCTTGGCATAGCTCGCCAGAGTCTTGCCGTCACGGCCGCCGAAAAGGTACGCATGTTGTCTCCAGTC
TGGATATAATGAGGCTTGTGACTAACCATTCAGATCATCATGATTCACCGGCCGTTCATGTTTCGGTCCTTTCAGTCACC
GGCGTATGCGCCTACCCGGCGAACGTGCGTCTCGGCATCCATGACAATCTTGCGCAACCACAGGAGCATTACCGAATCGG
GCGAAGTTTCGCTGTGGACCCATACGGCCTTCTGTATCACGGCAGCCTTGATTCTCTGCTTTGAAATCATCTGCAATCGG
GGAGAAGACCACGCAGACGACCTGCATAGTCAAAGAGCCATGTACGGAAATGCAATTGATCACGCGCGCCAGTACTTGAC
AAGTCGTACTGGCGACGTGCTGGCCCAGCGTGGTGTGCTGCTGATCAATGCCATCTTCTCGGGAGTTCCTGGAGAAGCCC
AGGCACCGGCCTCAATCAGCTTTGCCGATGTTGTCTCTCGTTTCACCTTGGACTGGGCTATCTTGGGCCTGAATAGCGAA
ATTCAACAGCAATCGGCGGAATCTCCGGTTGACTTGCGGCCTACACTTCGAGGATCACCTAGTGTGCATGGGGCTGGCTT
CAGTCCAGAGTTTGAAGACTTTGATGCCTGGTTCCAGCATATCTTCTCCACCGGTGCCGAAGCGTTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62