GenePrediction:GLEAN_4932 Details

Name: GLEAN_4932
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:538664..536753 (- strand)
Length: 1912
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:538664..538294 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_89:538237..537773 (- strand)
Length: 465
Type: CDS
Source: GLEAN
Position: GCSC_89:537707..536753 (- strand)
Length: 955
>GLEAN_4932 class=GenePrediction position=GCSC_89:538664..536753 (- strand)
ATGCTGGGCGACTTGCATTCTTTGCTGGTGTTTGCCAGCGAGGTATACGACCAGTACAAGACTCTAGGCAGAGAAGCCAC
GGAATTGAAGCGCCGTGTCAAAATATTGACACGGCTGCTGAAATCGTACAACGTTATGGTCGGAAACGCAGACAGATCGA
ATCTACTCGGCCCTGGTGAAATCGCCACCATGCGCACCATGTGCCGCAGCCTTCGGAAAGCTCTCGAACAAGCTGATGAG
TTTGTCAAGCGGCTGAAAAGACATGTGAAGGCGATGATGGCGCTCATCAACTCGCCTGCATGCAGGATATTGCTCGAAAC
GCTGACGACGCGAAGTACCGAGCTGACTGGTTTTGCCGTGATTCTCAACTTGTGAGTATACCTTACACCCGCCTCTGGTG
CTCTGCCTCCATCGCTAACGCAACCAGATGTATTCTGTTGGAGTCGAAAAAAGAAAGCCGTGTGTACGAACGCGTCAAAG
CCGCAAATATACCTTCATCAGCCCTGGACTTCACCCGTGATCTGCTGATGTCAGGAAAATACATCGACTTGACCTTTCCC
AACGGTAACACATCTCTCCATTACGCGTGCAGGGCCGGTGACCTGCCCCTGGTCCGACTGCTTCTCCGCAATCAGGCAGA
CCCGGGCAAGATGACCAACGATTTGCAGAATTCACTACACCTGGCCGCAGCCAAGGGGCGCATCGACATTCTTACCGCGA
TCCTCGCCCACGTGGCCGATTACCGGCCGACAGAGATGACCGTCCTATTAGAGCAGGTGGATGGCCATCAGAATACGCTG
CTGCACGCGGCATTGCAAGCCAAGTCGCTTTCGACAATCGAATTTGTTACCAAGCAGCTGGCCGATGCCGGCTGCACCAA
CACCATCAATGCGTGCAACAAAGACGGCTCCCTACGGCGCTACATCTTGCGCTGGGACTGTCTAACAGCCTTGACAGTGG
CGGCTGGATCGCCCGGCGTCTTCTCCGGACGGCTAAGCAAGTCAAGATTGCGAAAATTTTGGCGATCCTGCTAGAGGCCA
AGGCATCCATTATAGACAATCGCGGTGAAGGGGCCGTCACCGGCCGGACGGTGCTGCACACGGCCGTCAAGGAGCAGAAG
CCATATGCAGTCAAGGCACTTCTGGTAGCAGTGCCCAGCCTCAAGGACGCCCGTGACAGCGCAGGCCAGACGGCCCTGGA
GTTGGCGGTGGAAAGCGGCCAGGTGGCCATTACCAAGGCACTGCTAAAGGCCGGATCACCGATCCAGACGCACAAGAAGG
CGGACACAACACTGCTACACATGGCAGCCAAGACGGGCAACGAGCGTGCTGCGCTCACGCTGCTACATGCCGGCTTTCCA
GGCCTCAACGCGCAAGACAGCACCGGCCGAACGGCGCTGTATATGGCAGCGGAAAGGGGCCACGTGGAGGTCGAGCGTGC
CTTGCTGGAGCATCGGGCATCGATCCGCATCGGACGCTTTGAGGACAGCAAGACGGCCCTGCACGTGGCGGTGGAAAATA
ATCATGTGGACGCGGTTCGGGCGCTCATCACGAGGCGGGCGACCATTATCGACATCTGCGACAACTCTGAAAAGACGGCT
CTGCATGTGGCCGCAGCTCGGGGCTTCGTCAGAATCGCCAAGCTCCTCGTTGCCGGGAGGTCGACGGTGGTGAACGCCCG
CACCGCCACCGGAAAGACGGCTCTGCACATTGCCGCGGCCAAGGACAGGCCTGGCGTCATCGATGTCCTGGTTGATGCCG
GAGCCTCTTTGAAGCTACTGGACGAAAATGGCCGCTCAGCCAAAGACATGGCTAAGAACAAGAATAACTGGGCGGCTATG
GCAGCGCTGGCCAAGGCTAAGCAGGAGCGGGAAAAGGAGAGAAAGGAGAGAGCAAGGAGCAGCCATAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62